ID: 1078915268

View in Genome Browser
Species Human (GRCh38)
Location 11:15772924-15772946
Sequence AATGAGGAGCCTAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078915263_1078915268 -6 Left 1078915263 11:15772907-15772929 CCCTGTGCTGTAAGAACAATGAG No data
Right 1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG No data
1078915264_1078915268 -7 Left 1078915264 11:15772908-15772930 CCTGTGCTGTAAGAACAATGAGG No data
Right 1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG No data
1078915262_1078915268 -5 Left 1078915262 11:15772906-15772928 CCCCTGTGCTGTAAGAACAATGA No data
Right 1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078915268 Original CRISPR AATGAGGAGCCTAAGGAGGA AGG Intergenic
No off target data available for this crispr