ID: 1078916504

View in Genome Browser
Species Human (GRCh38)
Location 11:15783644-15783666
Sequence CTGACAGTCATCTGCTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078916504_1078916513 19 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916513 11:15783686-15783708 GAGGGCCTGAGGGAAAGGAGAGG No data
1078916504_1078916515 27 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data
1078916504_1078916509 9 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916509 11:15783676-15783698 TTCCGCACCTGAGGGCCTGAGGG No data
1078916504_1078916511 14 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916511 11:15783681-15783703 CACCTGAGGGCCTGAGGGAAAGG No data
1078916504_1078916505 0 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916505 11:15783667-15783689 CTCCTCTTATTCCGCACCTGAGG No data
1078916504_1078916506 1 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916506 11:15783668-15783690 TCCTCTTATTCCGCACCTGAGGG No data
1078916504_1078916508 8 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916508 11:15783675-15783697 ATTCCGCACCTGAGGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078916504 Original CRISPR CTGACAGTCATCTGCTTATC AGG (reversed) Intergenic
No off target data available for this crispr