ID: 1078916507

View in Genome Browser
Species Human (GRCh38)
Location 11:15783669-15783691
Sequence GCCCTCAGGTGCGGAATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078916507_1078916515 2 Left 1078916507 11:15783669-15783691 CCTCTTATTCCGCACCTGAGGGC No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data
1078916507_1078916513 -6 Left 1078916507 11:15783669-15783691 CCTCTTATTCCGCACCTGAGGGC No data
Right 1078916513 11:15783686-15783708 GAGGGCCTGAGGGAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078916507 Original CRISPR GCCCTCAGGTGCGGAATAAG AGG (reversed) Intergenic
No off target data available for this crispr