ID: 1078916510

View in Genome Browser
Species Human (GRCh38)
Location 11:15783678-15783700
Sequence TTCCCTCAGGCCCTCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078916510_1078916515 -7 Left 1078916510 11:15783678-15783700 CCGCACCTGAGGGCCTGAGGGAA No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078916510 Original CRISPR TTCCCTCAGGCCCTCAGGTG CGG (reversed) Intergenic
No off target data available for this crispr