ID: 1078916513

View in Genome Browser
Species Human (GRCh38)
Location 11:15783686-15783708
Sequence GAGGGCCTGAGGGAAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078916503_1078916513 22 Left 1078916503 11:15783641-15783663 CCGCCTGATAAGCAGATGACTGT No data
Right 1078916513 11:15783686-15783708 GAGGGCCTGAGGGAAAGGAGAGG No data
1078916507_1078916513 -6 Left 1078916507 11:15783669-15783691 CCTCTTATTCCGCACCTGAGGGC No data
Right 1078916513 11:15783686-15783708 GAGGGCCTGAGGGAAAGGAGAGG No data
1078916504_1078916513 19 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916513 11:15783686-15783708 GAGGGCCTGAGGGAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078916513 Original CRISPR GAGGGCCTGAGGGAAAGGAG AGG Intergenic
No off target data available for this crispr