ID: 1078916515

View in Genome Browser
Species Human (GRCh38)
Location 11:15783694-15783716
Sequence GAGGGAAAGGAGAGGCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078916504_1078916515 27 Left 1078916504 11:15783644-15783666 CCTGATAAGCAGATGACTGTCAG No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data
1078916503_1078916515 30 Left 1078916503 11:15783641-15783663 CCGCCTGATAAGCAGATGACTGT No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data
1078916510_1078916515 -7 Left 1078916510 11:15783678-15783700 CCGCACCTGAGGGCCTGAGGGAA No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data
1078916507_1078916515 2 Left 1078916507 11:15783669-15783691 CCTCTTATTCCGCACCTGAGGGC No data
Right 1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078916515 Original CRISPR GAGGGAAAGGAGAGGCCCGC TGG Intergenic
No off target data available for this crispr