ID: 1078919892

View in Genome Browser
Species Human (GRCh38)
Location 11:15819980-15820002
Sequence CTGTGGGTGTGGAGTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078919892_1078919898 -5 Left 1078919892 11:15819980-15820002 CCTGCTTGACTCCACACCCACAG No data
Right 1078919898 11:15819998-15820020 CACAGGGTCACACTTGATCCAGG No data
1078919892_1078919900 -3 Left 1078919892 11:15819980-15820002 CCTGCTTGACTCCACACCCACAG No data
Right 1078919900 11:15820000-15820022 CAGGGTCACACTTGATCCAGGGG No data
1078919892_1078919899 -4 Left 1078919892 11:15819980-15820002 CCTGCTTGACTCCACACCCACAG No data
Right 1078919899 11:15819999-15820021 ACAGGGTCACACTTGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078919892 Original CRISPR CTGTGGGTGTGGAGTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr