ID: 1078920494

View in Genome Browser
Species Human (GRCh38)
Location 11:15826162-15826184
Sequence AGGAGAGAGCAGGCCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078920494_1078920498 5 Left 1078920494 11:15826162-15826184 CCTCTCCAGGCCTGCTCTCTCCT No data
Right 1078920498 11:15826190-15826212 CTGCCAGCTGCGTCCCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078920494 Original CRISPR AGGAGAGAGCAGGCCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr