ID: 1078920672

View in Genome Browser
Species Human (GRCh38)
Location 11:15827234-15827256
Sequence AAGTGTAAACAGGAGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078920672_1078920680 29 Left 1078920672 11:15827234-15827256 CCCCCAACCTCCTGTTTACACTT No data
Right 1078920680 11:15827286-15827308 CCAGTTTAGTCACTCTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078920672 Original CRISPR AAGTGTAAACAGGAGGTTGG GGG (reversed) Intergenic
No off target data available for this crispr