ID: 1078921879

View in Genome Browser
Species Human (GRCh38)
Location 11:15838307-15838329
Sequence CTGCTCTGAAAGGAAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078921879_1078921889 21 Left 1078921879 11:15838307-15838329 CCAGGCCTTTCCTTTCAGAGCAG No data
Right 1078921889 11:15838351-15838373 GTATAAACTCTGGTCAAGGTGGG No data
1078921879_1078921887 17 Left 1078921879 11:15838307-15838329 CCAGGCCTTTCCTTTCAGAGCAG No data
Right 1078921887 11:15838347-15838369 CTGAGTATAAACTCTGGTCAAGG No data
1078921879_1078921888 20 Left 1078921879 11:15838307-15838329 CCAGGCCTTTCCTTTCAGAGCAG No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921879_1078921885 11 Left 1078921879 11:15838307-15838329 CCAGGCCTTTCCTTTCAGAGCAG No data
Right 1078921885 11:15838341-15838363 CTCCGTCTGAGTATAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078921879 Original CRISPR CTGCTCTGAAAGGAAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr