ID: 1078921883

View in Genome Browser
Species Human (GRCh38)
Location 11:15838335-15838357
Sequence TTTATACTCAGACGGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078921883_1078921891 21 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921891 11:15838379-15838401 TGCTCTTCTTGAGGCGAGCATGG No data
1078921883_1078921889 -7 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921889 11:15838351-15838373 GTATAAACTCTGGTCAAGGTGGG No data
1078921883_1078921888 -8 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921883_1078921890 12 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921890 11:15838370-15838392 TGGGAACTATGCTCTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078921883 Original CRISPR TTTATACTCAGACGGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr