ID: 1078921884

View in Genome Browser
Species Human (GRCh38)
Location 11:15838336-15838358
Sequence GTTTATACTCAGACGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078921884_1078921891 20 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921891 11:15838379-15838401 TGCTCTTCTTGAGGCGAGCATGG No data
1078921884_1078921889 -8 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921889 11:15838351-15838373 GTATAAACTCTGGTCAAGGTGGG No data
1078921884_1078921890 11 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921890 11:15838370-15838392 TGGGAACTATGCTCTTCTTGAGG No data
1078921884_1078921888 -9 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078921884 Original CRISPR GTTTATACTCAGACGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr