ID: 1078921888

View in Genome Browser
Species Human (GRCh38)
Location 11:15838350-15838372
Sequence AGTATAAACTCTGGTCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078921879_1078921888 20 Left 1078921879 11:15838307-15838329 CCAGGCCTTTCCTTTCAGAGCAG No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921880_1078921888 15 Left 1078921880 11:15838312-15838334 CCTTTCCTTTCAGAGCAGCTACT No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921884_1078921888 -9 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921883_1078921888 -8 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data
1078921881_1078921888 10 Left 1078921881 11:15838317-15838339 CCTTTCAGAGCAGCTACTCCCTG No data
Right 1078921888 11:15838350-15838372 AGTATAAACTCTGGTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078921888 Original CRISPR AGTATAAACTCTGGTCAAGG TGG Intergenic
No off target data available for this crispr