ID: 1078921891

View in Genome Browser
Species Human (GRCh38)
Location 11:15838379-15838401
Sequence TGCTCTTCTTGAGGCGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078921883_1078921891 21 Left 1078921883 11:15838335-15838357 CCCTGGCTCCGTCTGAGTATAAA No data
Right 1078921891 11:15838379-15838401 TGCTCTTCTTGAGGCGAGCATGG No data
1078921884_1078921891 20 Left 1078921884 11:15838336-15838358 CCTGGCTCCGTCTGAGTATAAAC No data
Right 1078921891 11:15838379-15838401 TGCTCTTCTTGAGGCGAGCATGG No data
1078921886_1078921891 13 Left 1078921886 11:15838343-15838365 CCGTCTGAGTATAAACTCTGGTC No data
Right 1078921891 11:15838379-15838401 TGCTCTTCTTGAGGCGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078921891 Original CRISPR TGCTCTTCTTGAGGCGAGCA TGG Intergenic
No off target data available for this crispr