ID: 1078923312

View in Genome Browser
Species Human (GRCh38)
Location 11:15851522-15851544
Sequence AGGGGCACTTGGAAGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078923312_1078923319 2 Left 1078923312 11:15851522-15851544 CCTGGTTTCTTCCAAGTGCCCCT No data
Right 1078923319 11:15851547-15851569 CCTCTCACTCTGATCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078923312 Original CRISPR AGGGGCACTTGGAAGAAACC AGG (reversed) Intergenic