ID: 1078923820

View in Genome Browser
Species Human (GRCh38)
Location 11:15856801-15856823
Sequence GGCCATGCTGACCACCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078923811_1078923820 25 Left 1078923811 11:15856753-15856775 CCATGCTGCTCTCTCTACTATGC No data
Right 1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG No data
1078923818_1078923820 -3 Left 1078923818 11:15856781-15856803 CCAGGCTGGGGAAGAGGAGTGGC No data
Right 1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG No data
1078923810_1078923820 26 Left 1078923810 11:15856752-15856774 CCCATGCTGCTCTCTCTACTATG No data
Right 1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078923820 Original CRISPR GGCCATGCTGACCACCCATA GGG Intergenic