ID: 1078925460

View in Genome Browser
Species Human (GRCh38)
Location 11:15870747-15870769
Sequence CCAATTTGCTTCTGTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078925460_1078925465 14 Left 1078925460 11:15870747-15870769 CCAGGGCCACAGAAGCAAATTGG No data
Right 1078925465 11:15870784-15870806 TAACTGTAATATCTATTCAAGGG No data
1078925460_1078925464 13 Left 1078925460 11:15870747-15870769 CCAGGGCCACAGAAGCAAATTGG No data
Right 1078925464 11:15870783-15870805 TTAACTGTAATATCTATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078925460 Original CRISPR CCAATTTGCTTCTGTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr