ID: 1078926757

View in Genome Browser
Species Human (GRCh38)
Location 11:15882043-15882065
Sequence CTTTCAACTGAGAGGTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078926753_1078926757 9 Left 1078926753 11:15882011-15882033 CCCGGATCTCAATTTGATTTGTG No data
Right 1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG No data
1078926754_1078926757 8 Left 1078926754 11:15882012-15882034 CCGGATCTCAATTTGATTTGTGA No data
Right 1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078926757 Original CRISPR CTTTCAACTGAGAGGTAACA TGG Intergenic
No off target data available for this crispr