ID: 1078926919

View in Genome Browser
Species Human (GRCh38)
Location 11:15883654-15883676
Sequence GTTGGCTTTCAATGTGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078926919_1078926923 1 Left 1078926919 11:15883654-15883676 CCACTGACACATTGAAAGCCAAC No data
Right 1078926923 11:15883678-15883700 TCCTGTCATTGTTCTTCATTGGG No data
1078926919_1078926928 29 Left 1078926919 11:15883654-15883676 CCACTGACACATTGAAAGCCAAC No data
Right 1078926928 11:15883706-15883728 CTGCTCAAAGTGTTCTATTTGGG No data
1078926919_1078926927 28 Left 1078926919 11:15883654-15883676 CCACTGACACATTGAAAGCCAAC No data
Right 1078926927 11:15883705-15883727 ACTGCTCAAAGTGTTCTATTTGG No data
1078926919_1078926922 0 Left 1078926919 11:15883654-15883676 CCACTGACACATTGAAAGCCAAC No data
Right 1078926922 11:15883677-15883699 CTCCTGTCATTGTTCTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078926919 Original CRISPR GTTGGCTTTCAATGTGTCAG TGG (reversed) Intergenic
No off target data available for this crispr