ID: 1078928917

View in Genome Browser
Species Human (GRCh38)
Location 11:15898354-15898376
Sequence TGATCCCCCTTTATAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078928917_1078928921 -5 Left 1078928917 11:15898354-15898376 CCTCCTCCTATAAAGGGGGATCA No data
Right 1078928921 11:15898372-15898394 GATCACCATACCTGCTTCATGGG No data
1078928917_1078928920 -6 Left 1078928917 11:15898354-15898376 CCTCCTCCTATAAAGGGGGATCA No data
Right 1078928920 11:15898371-15898393 GGATCACCATACCTGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078928917 Original CRISPR TGATCCCCCTTTATAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr