ID: 1078930003

View in Genome Browser
Species Human (GRCh38)
Location 11:15905578-15905600
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930003_1078930020 25 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930003_1078930012 7 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data
1078930003_1078930019 24 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930003_1078930014 13 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930003 Original CRISPR GCGGGCCAGCAGGCGCTGCC GGG (reversed) Intergenic