ID: 1078930004

View in Genome Browser
Species Human (GRCh38)
Location 11:15905579-15905601
Sequence TGCGGGCCAGCAGGCGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930004_1078930019 23 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930004_1078930014 12 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930004_1078930020 24 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930004_1078930012 6 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data
1078930004_1078930021 30 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930004 Original CRISPR TGCGGGCCAGCAGGCGCTGC CGG (reversed) Intergenic