ID: 1078930007

View in Genome Browser
Species Human (GRCh38)
Location 11:15905588-15905610
Sequence CAGGCCCGGTGCGGGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930007_1078930022 22 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data
1078930007_1078930020 15 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930007_1078930019 14 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930007_1078930012 -3 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data
1078930007_1078930021 21 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930007_1078930014 3 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930007_1078930023 23 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930007 Original CRISPR CAGGCCCGGTGCGGGCCAGC AGG (reversed) Intergenic