ID: 1078930008

View in Genome Browser
Species Human (GRCh38)
Location 11:15905596-15905618
Sequence TTGGGCTGCAGGCCCGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930008_1078930019 6 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930008_1078930023 15 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930008_1078930020 7 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930008_1078930014 -5 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930008_1078930021 13 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930008_1078930022 14 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930008 Original CRISPR TTGGGCTGCAGGCCCGGTGC GGG (reversed) Intergenic