ID: 1078930009

View in Genome Browser
Species Human (GRCh38)
Location 11:15905597-15905619
Sequence GTTGGGCTGCAGGCCCGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930009_1078930019 5 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930009_1078930014 -6 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930009_1078930022 13 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data
1078930009_1078930021 12 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930009_1078930023 14 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930009_1078930020 6 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930009 Original CRISPR GTTGGGCTGCAGGCCCGGTG CGG (reversed) Intergenic