ID: 1078930011

View in Genome Browser
Species Human (GRCh38)
Location 11:15905607-15905629
Sequence CTGTGGGCAGGTTGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930011_1078930019 -5 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG No data
1078930011_1078930020 -4 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930011_1078930022 3 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data
1078930011_1078930023 4 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930011_1078930021 2 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930011 Original CRISPR CTGTGGGCAGGTTGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr