ID: 1078930012

View in Genome Browser
Species Human (GRCh38)
Location 11:15905608-15905630
Sequence CTGCAGCCCAACCTGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930003_1078930012 7 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data
1078930004_1078930012 6 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data
1078930007_1078930012 -3 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930012 11:15905608-15905630 CTGCAGCCCAACCTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930012 Original CRISPR CTGCAGCCCAACCTGCCCAC AGG Intergenic
No off target data available for this crispr