ID: 1078930014

View in Genome Browser
Species Human (GRCh38)
Location 11:15905614-15905636
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930004_1078930014 12 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930009_1078930014 -6 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930008_1078930014 -5 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930007_1078930014 3 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
1078930003_1078930014 13 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930014 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930014 Original CRISPR CCCAACCTGCCCACAGGCGC TGG Intergenic