ID: 1078930015 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:15905615-15905637 |
Sequence | GCCAGCGCCTGTGGGCAGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1078930015_1078930021 | -6 | Left | 1078930015 | 11:15905615-15905637 | CCAACCTGCCCACAGGCGCTGGC | No data | ||
Right | 1078930021 | 11:15905632-15905654 | GCTGGCCACCGCCTGGGCAGCGG | No data | ||||
1078930015_1078930023 | -4 | Left | 1078930015 | 11:15905615-15905637 | CCAACCTGCCCACAGGCGCTGGC | No data | ||
Right | 1078930023 | 11:15905634-15905656 | TGGCCACCGCCTGGGCAGCGGGG | No data | ||||
1078930015_1078930022 | -5 | Left | 1078930015 | 11:15905615-15905637 | CCAACCTGCCCACAGGCGCTGGC | No data | ||
Right | 1078930022 | 11:15905633-15905655 | CTGGCCACCGCCTGGGCAGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1078930015 | Original CRISPR | GCCAGCGCCTGTGGGCAGGT TGG (reversed) | Intergenic | ||