ID: 1078930015

View in Genome Browser
Species Human (GRCh38)
Location 11:15905615-15905637
Sequence GCCAGCGCCTGTGGGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930015_1078930021 -6 Left 1078930015 11:15905615-15905637 CCAACCTGCCCACAGGCGCTGGC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930015_1078930023 -4 Left 1078930015 11:15905615-15905637 CCAACCTGCCCACAGGCGCTGGC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930015_1078930022 -5 Left 1078930015 11:15905615-15905637 CCAACCTGCCCACAGGCGCTGGC No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930015 Original CRISPR GCCAGCGCCTGTGGGCAGGT TGG (reversed) Intergenic