ID: 1078930016

View in Genome Browser
Species Human (GRCh38)
Location 11:15905619-15905641
Sequence GGTGGCCAGCGCCTGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930016_1078930023 -8 Left 1078930016 11:15905619-15905641 CCTGCCCACAGGCGCTGGCCACC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930016_1078930022 -9 Left 1078930016 11:15905619-15905641 CCTGCCCACAGGCGCTGGCCACC No data
Right 1078930022 11:15905633-15905655 CTGGCCACCGCCTGGGCAGCGGG No data
1078930016_1078930021 -10 Left 1078930016 11:15905619-15905641 CCTGCCCACAGGCGCTGGCCACC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930016 Original CRISPR GGTGGCCAGCGCCTGTGGGC AGG (reversed) Intergenic