ID: 1078930020

View in Genome Browser
Species Human (GRCh38)
Location 11:15905626-15905648
Sequence ACAGGCGCTGGCCACCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930007_1078930020 15 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930010_1078930020 1 Left 1078930010 11:15905602-15905624 CCGGGCCTGCAGCCCAACCTGCC No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930003_1078930020 25 Left 1078930003 11:15905578-15905600 CCCGGCAGCGCCTGCTGGCCCGC No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930008_1078930020 7 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930011_1078930020 -4 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930009_1078930020 6 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data
1078930004_1078930020 24 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930020 11:15905626-15905648 ACAGGCGCTGGCCACCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930020 Original CRISPR ACAGGCGCTGGCCACCGCCT GGG Intergenic
No off target data available for this crispr