ID: 1078930021

View in Genome Browser
Species Human (GRCh38)
Location 11:15905632-15905654
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930009_1078930021 12 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930015_1078930021 -6 Left 1078930015 11:15905615-15905637 CCAACCTGCCCACAGGCGCTGGC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930016_1078930021 -10 Left 1078930016 11:15905619-15905641 CCTGCCCACAGGCGCTGGCCACC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930004_1078930021 30 Left 1078930004 11:15905579-15905601 CCGGCAGCGCCTGCTGGCCCGCA No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930008_1078930021 13 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930010_1078930021 7 Left 1078930010 11:15905602-15905624 CCGGGCCTGCAGCCCAACCTGCC No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930013_1078930021 -5 Left 1078930013 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930007_1078930021 21 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data
1078930011_1078930021 2 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930021 11:15905632-15905654 GCTGGCCACCGCCTGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930021 Original CRISPR GCTGGCCACCGCCTGGGCAG CGG Intergenic