ID: 1078930023

View in Genome Browser
Species Human (GRCh38)
Location 11:15905634-15905656
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078930007_1078930023 23 Left 1078930007 11:15905588-15905610 CCTGCTGGCCCGCACCGGGCCTG No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930008_1078930023 15 Left 1078930008 11:15905596-15905618 CCCGCACCGGGCCTGCAGCCCAA No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930009_1078930023 14 Left 1078930009 11:15905597-15905619 CCGCACCGGGCCTGCAGCCCAAC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930013_1078930023 -3 Left 1078930013 11:15905614-15905636 CCCAACCTGCCCACAGGCGCTGG No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930010_1078930023 9 Left 1078930010 11:15905602-15905624 CCGGGCCTGCAGCCCAACCTGCC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930011_1078930023 4 Left 1078930011 11:15905607-15905629 CCTGCAGCCCAACCTGCCCACAG No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930016_1078930023 -8 Left 1078930016 11:15905619-15905641 CCTGCCCACAGGCGCTGGCCACC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data
1078930015_1078930023 -4 Left 1078930015 11:15905615-15905637 CCAACCTGCCCACAGGCGCTGGC No data
Right 1078930023 11:15905634-15905656 TGGCCACCGCCTGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078930023 Original CRISPR TGGCCACCGCCTGGGCAGCG GGG Intergenic