ID: 1078932434

View in Genome Browser
Species Human (GRCh38)
Location 11:15922576-15922598
Sequence AAGCTCTGACAACCTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078932434_1078932440 29 Left 1078932434 11:15922576-15922598 CCTCTGCCAGGTTGTCAGAGCTT No data
Right 1078932440 11:15922628-15922650 TATTCCTCCAGCACCCAGCTGGG No data
1078932434_1078932439 28 Left 1078932434 11:15922576-15922598 CCTCTGCCAGGTTGTCAGAGCTT No data
Right 1078932439 11:15922627-15922649 TTATTCCTCCAGCACCCAGCTGG No data
1078932434_1078932437 -7 Left 1078932434 11:15922576-15922598 CCTCTGCCAGGTTGTCAGAGCTT No data
Right 1078932437 11:15922592-15922614 AGAGCTTGAAGGCAAATTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078932434 Original CRISPR AAGCTCTGACAACCTGGCAG AGG (reversed) Intergenic
No off target data available for this crispr