ID: 1078935442

View in Genome Browser
Species Human (GRCh38)
Location 11:15945424-15945446
Sequence GCCCTTCAGCATCAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078935442_1078935447 -7 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935447 11:15945440-15945462 GAAGGGCACATGGGGTATTTTGG No data
1078935442_1078935450 4 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935450 11:15945451-15945473 GGGGTATTTTGGGGAGACTCTGG No data
1078935442_1078935448 -6 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935448 11:15945441-15945463 AAGGGCACATGGGGTATTTTGGG No data
1078935442_1078935451 5 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935451 11:15945452-15945474 GGGTATTTTGGGGAGACTCTGGG No data
1078935442_1078935452 21 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935452 11:15945468-15945490 CTCTGGGAGCCCAGAAAGCCTGG No data
1078935442_1078935449 -5 Left 1078935442 11:15945424-15945446 CCAGCAGCCTGATGCTGAAGGGC No data
Right 1078935449 11:15945442-15945464 AGGGCACATGGGGTATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078935442 Original CRISPR GCCCTTCAGCATCAGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr