ID: 1078935569

View in Genome Browser
Species Human (GRCh38)
Location 11:15946582-15946604
Sequence TAAGATGCACAACATTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078935569_1078935573 25 Left 1078935569 11:15946582-15946604 CCAGGCTAATGTTGTGCATCTTA No data
Right 1078935573 11:15946630-15946652 CACCACCTGCAACCAGGAAAAGG No data
1078935569_1078935572 19 Left 1078935569 11:15946582-15946604 CCAGGCTAATGTTGTGCATCTTA No data
Right 1078935572 11:15946624-15946646 ATCATTCACCACCTGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078935569 Original CRISPR TAAGATGCACAACATTAGCC TGG (reversed) Intergenic
No off target data available for this crispr