ID: 1078936221

View in Genome Browser
Species Human (GRCh38)
Location 11:15952652-15952674
Sequence CCTACCAGGCAGAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078936217_1078936221 3 Left 1078936217 11:15952626-15952648 CCAGAAAAGTGGCAGTCAGGCTT No data
Right 1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG No data
1078936211_1078936221 15 Left 1078936211 11:15952614-15952636 CCTACTCAACCCCCAGAAAAGTG No data
Right 1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG No data
1078936216_1078936221 4 Left 1078936216 11:15952625-15952647 CCCAGAAAAGTGGCAGTCAGGCT No data
Right 1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG No data
1078936215_1078936221 5 Left 1078936215 11:15952624-15952646 CCCCAGAAAAGTGGCAGTCAGGC No data
Right 1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG No data
1078936213_1078936221 6 Left 1078936213 11:15952623-15952645 CCCCCAGAAAAGTGGCAGTCAGG No data
Right 1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078936221 Original CRISPR CCTACCAGGCAGAGACTGGA AGG Intergenic
No off target data available for this crispr