ID: 1078937486

View in Genome Browser
Species Human (GRCh38)
Location 11:15964615-15964637
Sequence ATGTGCCAAGCACTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078937482_1078937486 7 Left 1078937482 11:15964585-15964607 CCTTCCACAAACAAGTGTAGAGC No data
Right 1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG No data
1078937480_1078937486 19 Left 1078937480 11:15964573-15964595 CCCTCATACATTCCTTCCACAAA No data
Right 1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG No data
1078937481_1078937486 18 Left 1078937481 11:15964574-15964596 CCTCATACATTCCTTCCACAAAC No data
Right 1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG No data
1078937483_1078937486 3 Left 1078937483 11:15964589-15964611 CCACAAACAAGTGTAGAGCACTT No data
Right 1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078937486 Original CRISPR ATGTGCCAAGCACTGTGTTG GGG Intergenic
No off target data available for this crispr