ID: 1078939926

View in Genome Browser
Species Human (GRCh38)
Location 11:15991204-15991226
Sequence CTGTGGGTATCGTGGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078939926_1078939930 14 Left 1078939926 11:15991204-15991226 CCTTTTTGCCACGATACCCACAG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078939926 Original CRISPR CTGTGGGTATCGTGGCAAAA AGG (reversed) Intronic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
915276112 1:154789364-154789386 CCCTGGATATCCTGGCAAAAGGG - Intronic
916657006 1:166885199-166885221 TTGTGGTTATTGTGGCAAAATGG - Intergenic
917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG + Intronic
919400759 1:197113401-197113423 CTGAAGGTAGCATGGCAAAAGGG + Intronic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG + Intronic
1078507331 11:11961986-11962008 TTGTGGCTATCATGACAAAATGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079616279 11:22497508-22497530 CTGTGAGTAATGTGGCAAACTGG - Intergenic
1082328935 11:51185809-51185831 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082335294 11:51278123-51278145 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082343172 11:51392886-51392908 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082361749 11:51663062-51663084 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082389693 11:52069527-52069549 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082400959 11:52232884-52232906 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082423307 11:52555924-52555946 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082443547 11:52848286-52848308 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082445964 11:52883145-52883167 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082482015 11:53405343-53405365 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082482432 11:53411293-53411315 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082510355 11:53814351-53814373 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082512072 11:53839011-53839033 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1082519599 11:53947850-53947872 CTGTGGATTTCGTTGGAAAAGGG + Intergenic
1082545403 11:54321433-54321455 CTGAGGATATCGTTGGAAAAGGG + Intergenic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG + Intergenic
1101169466 12:102075039-102075061 CACTGGTTATCCTGGCAAAATGG - Exonic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1118375401 14:65172576-65172598 CTGTGGTTTTCCTGCCAAAAAGG + Intergenic
1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG + Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG + Intergenic
1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG + Intergenic
1124820334 15:33038953-33038975 GTGTGGGTATCTTGTTAAAAAGG + Intronic
1128014952 15:64335934-64335956 CTGGGGGTATAGTGACAAACAGG - Intronic
1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG + Intronic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1155774125 18:29737550-29737572 CTGCTGGTAATGTGGCAAAATGG + Intergenic
1156680489 18:39582670-39582692 ATGTGGGTTTCTTGCCAAAATGG - Intergenic
1159769559 18:72532975-72532997 CTGAGGCTATCCTAGCAAAATGG - Intergenic
927928424 2:27028458-27028480 ATGTGGGTTACATGGCAAAAGGG + Intergenic
944379392 2:199090415-199090437 GTGTACGTAACGTGGCAAAAAGG + Intergenic
945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG + Intronic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG + Intergenic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1178788011 21:35672464-35672486 CTGTAGTTATACTGGCAAAATGG - Intronic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
1185197388 22:49480630-49480652 CTTTGGGTTTTGTGTCAAAAGGG - Intronic
955188932 3:56742071-56742093 CAGTGAGTATCATGGCACAAGGG - Intronic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG + Intergenic
969252819 4:5980990-5981012 TTGTGGGAAGTGTGGCAAAATGG + Intronic
983141521 4:164155201-164155223 CTGTGGGTATCCAGGCTTAAGGG + Intronic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1027876186 7:83772125-83772147 ATGTGGGCACCGTGGCAAACTGG - Intergenic
1028253509 7:88563935-88563957 CTGTGGGTATGTTCTCAAAATGG - Intergenic
1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG + Intronic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1036000387 8:4596025-4596047 CTGTGGGCAGTGTGGCAAACAGG - Intronic
1042307497 8:67346654-67346676 TTGTGGAGATCGTGGCACAAGGG + Intergenic
1043114270 8:76230155-76230177 CTGTGGCTGTCTTGCCAAAATGG - Intergenic
1043286554 8:78538893-78538915 GTGTGGGTGTCTTGGCAGAAAGG + Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG + Intergenic
1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG + Intronic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190437503 X:50440357-50440379 TTGTTGGTTTCGTGGAAAAATGG - Intronic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1193339345 X:80328833-80328855 CTATGGGTATCCTGGTAATAAGG + Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic