ID: 1078939930

View in Genome Browser
Species Human (GRCh38)
Location 11:15991241-15991263
Sequence TTAAAATGCACTGACCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078939929_1078939930 -3 Left 1078939929 11:15991221-15991243 CCACAGTACATTAATTTCATTTA 0: 1
1: 0
2: 1
3: 54
4: 419
Right 1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1078939926_1078939930 14 Left 1078939926 11:15991204-15991226 CCTTTTTGCCACGATACCCACAG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1078939928_1078939930 -2 Left 1078939928 11:15991220-15991242 CCCACAGTACATTAATTTCATTT 0: 1
1: 0
2: 7
3: 43
4: 446
Right 1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1078939927_1078939930 6 Left 1078939927 11:15991212-15991234 CCACGATACCCACAGTACATTAA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078939930 Original CRISPR TTAAAATGCACTGACCATAC AGG Intronic
902070604 1:13732141-13732163 TTACTATGCACTGACCATAACGG - Intronic
902699881 1:18164587-18164609 TAAAATTGCACTGATCAGACGGG - Intronic
902947420 1:19851809-19851831 TTAGAATGCCCTGACCATATGGG + Intergenic
904844170 1:33396320-33396342 TTAAAATCAACTGTCCATTCAGG - Intronic
905747520 1:40431175-40431197 TTAAAAAGCACTAATCATAAAGG + Intergenic
906389415 1:45401094-45401116 TTAAAAAACACTGACACTACTGG + Intronic
906883872 1:49623083-49623105 TTTAAGTGCAGAGACCATACAGG + Intronic
909334891 1:74461027-74461049 TTTAAATGTGCTCACCATACTGG + Intronic
909487768 1:76192646-76192668 TTAAAATGCACTGCCTTAACTGG + Intronic
909867803 1:80696083-80696105 TTAAAATGCAGTGATGAGACAGG - Intergenic
909932986 1:81519629-81519651 GTAAAATGCATTGCACATACTGG - Intronic
911420496 1:97635150-97635172 TTAAAAGGCACTGACCATAGAGG + Intronic
916177190 1:162052284-162052306 TCAAACTCCACTAACCATACAGG + Intergenic
916757441 1:167786273-167786295 TTAAAATGCACTGAGGTAACTGG - Intronic
919263612 1:195232557-195232579 TTGAAAAGCAATGACCATACAGG - Intergenic
919653382 1:200173282-200173304 TTAAAGGGCACTGACCATCCTGG + Intronic
923348921 1:233084799-233084821 CTAAAATGCTCTGACATTACGGG + Intronic
1064605131 10:17031157-17031179 TCAAAATGCATTAACCATGCAGG + Intronic
1067482047 10:46607762-46607784 TTAAAATGGACTTACCAGGCAGG - Intergenic
1067612703 10:47733964-47733986 TTAAAATGGACTTACCAGGCAGG + Intergenic
1068851422 10:61746214-61746236 TTAAAATGCACTGAGAATCATGG + Intronic
1070050191 10:72881367-72881389 ATGAAAAGCACTAACCATACAGG + Intronic
1071540219 10:86476067-86476089 TTAAAAAGCACTGACTAGGCCGG + Intronic
1076716916 10:132370750-132370772 TTGAAATGGACTGAGCCTACAGG - Intronic
1078939930 11:15991241-15991263 TTAAAATGCACTGACCATACAGG + Intronic
1082752876 11:57039949-57039971 TTCAAATCTACTGACCAAACAGG + Intergenic
1089879661 11:121761663-121761685 TTAAAATGGACTGTAGATACAGG - Intergenic
1093369483 12:18350042-18350064 TAAAGAAGCAATGACCATACAGG + Intronic
1096201425 12:49686279-49686301 TTAAAATGTACTGAGCATCCTGG + Intronic
1098855380 12:75646804-75646826 TTTAACTGCTCTGACCATGCCGG - Intergenic
1101713546 12:107290449-107290471 TTAAAATGAGCTGAGCATGCTGG - Intergenic
1104461461 12:128959539-128959561 AATAAATGCACTGACCATCCTGG + Intronic
1108083217 13:46758937-46758959 TTAAAAAGCACAGAGCATAATGG - Intergenic
1109134465 13:58629238-58629260 TTTAAATTCACTGAACATATTGG - Intergenic
1114176129 14:20322013-20322035 TTAAATTGCACATACCATTCAGG - Intronic
1116581893 14:46652432-46652454 GGAAAATGAACTGACCAAACTGG - Intergenic
1118615224 14:67570358-67570380 TTAAAATGTAGTGACGTTACGGG - Intronic
1120148937 14:81011290-81011312 TAAAAATGCACTAACCAGAATGG - Intronic
1120177057 14:81305735-81305757 TTAAAAAGGACTAACCATAAAGG - Intronic
1120403869 14:84069628-84069650 TTCAAAAGCACCTACCATACGGG + Intergenic
1121190553 14:92025585-92025607 TAAAAATGCACTGACCAGCCGGG + Intronic
1126188268 15:45852192-45852214 TTAAAATGCACTTACTGTGCAGG + Intergenic
1127266568 15:57367062-57367084 TTAAAATTAACTGAGCATGCTGG - Intergenic
1127567203 15:60202701-60202723 GTAAAATGCACTGAACACAGTGG - Intergenic
1131165162 15:90136877-90136899 ATAAAAAGGACTGTCCATACAGG - Intergenic
1131778251 15:95825908-95825930 TTAAAAGGCACTTACCAGAGTGG + Intergenic
1131983818 15:98021121-98021143 TTATAATGAACTGAGCATATAGG - Intergenic
1135249983 16:20892724-20892746 TTACAGTGCACTGACCATTTTGG + Intronic
1136475346 16:30509721-30509743 TTAAAATGAGCTGAGCATAGTGG - Intronic
1140581225 16:76233531-76233553 TGCAACTGCACTGACCATTCAGG - Intergenic
1140979944 16:80098531-80098553 TTAAAAAGCACTAACCCTAAAGG - Intergenic
1141197800 16:81874379-81874401 TTAAAATGCAGTGACCAAACTGG - Intronic
1146557901 17:33842370-33842392 TTAAGATGCATCTACCATACAGG + Intronic
1147135756 17:38433433-38433455 TTAGATTGCTCTGACCATAAAGG - Intronic
1148290401 17:46443094-46443116 ATAAAATGCACAGAACATGCAGG + Intergenic
1148312569 17:46660667-46660689 ATAAAATGCACAGAACATGCAGG + Intronic
1153345965 18:4026454-4026476 TCAAAATTCACAGACCAAACAGG + Intronic
1155115084 18:22756936-22756958 TTAAAATTCACTGAGCATGCTGG + Intergenic
1156423470 18:36981433-36981455 GTAAAATGCAATCCCCATACAGG + Intronic
1158326234 18:56316337-56316359 TTAAAATGTAAAGACCATTCTGG - Intergenic
1158770463 18:60510717-60510739 ATAAAATGCACTGACAACTCAGG + Intergenic
1166285285 19:41822355-41822377 TTAAACTACACTGACCAACCTGG + Intergenic
1168481240 19:56722014-56722036 TTTAAATGCATGGATCATACAGG - Intergenic
1168669748 19:58231467-58231489 TCAAAATCCACTGACCACTCAGG - Intronic
927941620 2:27106954-27106976 TTTAGATGTTCTGACCATACAGG - Intronic
928590625 2:32810999-32811021 TAAAAATGCACAGAACAAACTGG - Intronic
930354279 2:50297731-50297753 CTAAAGTGTAATGACCATACAGG + Intronic
930584016 2:53248445-53248467 TAAAAATGCACTGATCTAACCGG + Intergenic
936276447 2:111101877-111101899 TTGAAATGGAGTGATCATACCGG + Intronic
937796114 2:126022402-126022424 TTAATATGCACTCAGCAAACTGG + Intergenic
938859353 2:135351202-135351224 TTAAAATGCAGTAGCCATAGTGG - Intronic
940092327 2:149934425-149934447 TTAAAATGCAGGGACCATGATGG - Intergenic
941195402 2:162444546-162444568 TTAAAATGCACTAAAAATTCTGG - Intronic
941521249 2:166546675-166546697 TTAAAATGCAGTGACAAAAAGGG + Intergenic
943493337 2:188584997-188585019 GTAAAATACAATGAGCATACAGG + Intronic
946721537 2:222613944-222613966 TGAAATTGCACTGACCAAATAGG + Intronic
1169767447 20:9162880-9162902 TTAAAATGTACAGACCTTTCCGG + Intronic
1173035598 20:39406467-39406489 TTCACATGCACTCACCATATGGG - Intergenic
1177271586 21:18855496-18855518 TTTAAATGAACTGACCTTATTGG + Intergenic
1177528367 21:22328172-22328194 TTAAAATGCAATGACCAGCCTGG - Intergenic
1181099678 22:20530984-20531006 TTATAAGGCACTGGACATACAGG - Intronic
1184881627 22:47308468-47308490 TCAAAATGCAATAACCATAAAGG - Intergenic
950354596 3:12396079-12396101 TTAAAATGCAATTACTATAAAGG - Intronic
950620201 3:14199361-14199383 TCAAAATGGAATGACCATAGCGG - Exonic
951214966 3:20015112-20015134 TTAAATCACACTGAGCATACAGG + Intergenic
952228378 3:31402892-31402914 TTAAAATGAACTGGGCATAGTGG - Intergenic
952234112 3:31461479-31461501 TTAAAATTCTCTGAGCAAACAGG + Intergenic
954189413 3:48946428-48946450 CTAAAATGCACAGACTATAGTGG - Intronic
959338824 3:105101493-105101515 TTAACATATACTGAACATACTGG - Intergenic
960057541 3:113285849-113285871 TTGAAATGCACAGACCAAAAAGG - Intronic
963181690 3:142363440-142363462 GTAAAATCAATTGACCATACAGG + Intronic
966197886 3:177331550-177331572 ATACAATGCACTGACCTTAAGGG + Intergenic
970421333 4:15908210-15908232 TTAAAATGGAGTGAGCATCCTGG + Intergenic
971875586 4:32304087-32304109 TTAAAATGTACTGAAAATAAAGG - Intergenic
972098787 4:35384341-35384363 TTAGAATGCCATGATCATACTGG + Intergenic
973947707 4:55976658-55976680 CTAAAATGCTCTGAACATCCTGG - Intronic
977637110 4:99312096-99312118 TTAAAATACACTGATCATTTGGG + Intronic
977784077 4:101012645-101012667 TTAAAATACACTGGGCAAACTGG + Intergenic
981961585 4:150546844-150546866 TTAATATGCATTGATCATAGAGG + Intronic
982329757 4:154168652-154168674 ATAAAAGGTACTAACCATACAGG - Intergenic
983125486 4:163945983-163946005 TTTAAATGCACTAAAAATACAGG - Intronic
983331824 4:166339802-166339824 TTAAAATGTACAGACCAAATTGG + Intergenic
983721429 4:170857331-170857353 TTAAAAGGCATTGAATATACTGG + Intergenic
986085002 5:4436187-4436209 TGAAAATGCACTTGACATACTGG - Intergenic
987474274 5:18371769-18371791 TCAATATACACAGACCATACAGG + Intergenic
987908413 5:24108948-24108970 TTTAAAGACACTGACCATATCGG + Intronic
988327699 5:29791308-29791330 TTATAATGTTCTGACCATAATGG - Intergenic
988333065 5:29868303-29868325 TTAAAATGAACAGAACAGACTGG + Intergenic
989078198 5:37587352-37587374 TTAAAATGCACAGTCTATATAGG - Intronic
991233227 5:64361643-64361665 TTAAAATGAACTAAGAATACTGG + Intronic
994101759 5:95901291-95901313 TAAAAATGCAATGGCCATTCTGG - Intronic
994703149 5:103162724-103162746 TTAAAATGCATTGACCCTAAGGG - Intronic
994724918 5:103423549-103423571 TTGAAATGCACTGGCAATAATGG - Intergenic
996558879 5:124807303-124807325 ATTAATTGCACTGACCATTCTGG + Intergenic
996869609 5:128173656-128173678 TTAAAATGTATTTACCTTACAGG + Intronic
1004752555 6:18578150-18578172 TTACAATGCACTGAGGATAAGGG + Intergenic
1005139488 6:22611612-22611634 TTACAATGCATAGACTATACCGG + Intergenic
1005783076 6:29213793-29213815 TTAAGATGCACTGACCCTCATGG - Intergenic
1006005366 6:30997713-30997735 TTAAAATGTAGTGACCAGGCTGG + Intergenic
1008401613 6:51069758-51069780 TTAAAATGCACTGTCCAACAGGG + Intergenic
1009891830 6:69694174-69694196 TTAAAATGCCCTGATATTACTGG - Intronic
1010213643 6:73382827-73382849 TTAAAAACCACTGAGCATATTGG - Intronic
1015069329 6:129071754-129071776 TGAAAATACACTGACCATAGTGG - Intronic
1017972986 6:159329202-159329224 TTAAACTGCAGTGACAATTCAGG - Intergenic
1019876173 7:3813037-3813059 TTAACATGTACTGAGCATTCAGG + Intronic
1021882125 7:25105188-25105210 TTAAAATGCAGTGACAACATAGG - Intergenic
1022676786 7:32508239-32508261 TTAAAAAGCACTAACCACAATGG - Intronic
1024746707 7:52415350-52415372 TTAAAATGCACAGATCAAAAGGG - Intergenic
1025005018 7:55346869-55346891 TTAAATAGCACTAACCATAATGG + Intergenic
1027588785 7:80091567-80091589 ATAAAATGGACTGAGGATACAGG - Intergenic
1030445437 7:109643136-109643158 ATAAAATGGAGTGTCCATACAGG + Intergenic
1031851632 7:126871606-126871628 ATAAAATGCACAGAACATTCAGG - Intronic
1033077993 7:138267674-138267696 TTAACATGCATTGACCAGAGAGG + Intergenic
1035472022 7:159116407-159116429 CCCAAATGCACTGACCATGCGGG - Intronic
1036397055 8:8378555-8378577 TTAAAACACACTGAACACACTGG + Intronic
1040453270 8:47570263-47570285 TGAAAATCAACTGACCATAGAGG - Intronic
1041291871 8:56315646-56315668 TTACACTGCACGGACCATACCGG - Intronic
1043070655 8:75631664-75631686 TTAGAATGCACTAACCATCTGGG + Intergenic
1051983291 9:23050420-23050442 TTAAAAAGCACTGAGTAAACTGG + Intergenic
1053396670 9:37781140-37781162 TTAAAGTGCTCTGACCATCTAGG - Intronic
1055217931 9:73889994-73890016 TTAAAATACAGTGACCAGAAGGG + Intergenic
1055692065 9:78843495-78843517 TAAAAATGGAGTTACCATACAGG - Intergenic
1185770777 X:2763974-2763996 TTAGAATGCCTTGACCATCCGGG - Intronic
1189507651 X:41628026-41628048 TTAAAATGGACTTATCTTACAGG + Intronic
1190356185 X:49607559-49607581 TTAAACAGCAGTGACCAAACGGG + Exonic
1193731618 X:85109348-85109370 TTATGATGCAGTGACCATGCAGG - Intergenic
1194118770 X:89935772-89935794 TTAAAAGGCACAGACCAGACTGG - Intergenic
1195108333 X:101621862-101621884 TTAAAATACACAGACAATATGGG - Intergenic
1199669222 X:150128122-150128144 TTAAGATGCACTGTCCAGCCTGG + Intergenic
1199912792 X:152305931-152305953 TTAAAATGCACTGGGACTACAGG + Intronic
1200471644 Y:3593334-3593356 TTAAAAGGCACAGACCAGACTGG - Intergenic
1200921350 Y:8616212-8616234 TTTACATGCACTCACCTTACAGG - Intergenic