ID: 1078940245

View in Genome Browser
Species Human (GRCh38)
Location 11:15995255-15995277
Sequence GCTTTCCACTGAAACTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078940241_1078940245 12 Left 1078940241 11:15995220-15995242 CCTATCAAGTTAGAAAGAATTCA 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1078940245 11:15995255-15995277 GCTTTCCACTGAAACTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078940245 Original CRISPR GCTTTCCACTGAAACTCCAG AGG Intronic
900678407 1:3902522-3902544 GTTTTCCACTTAAACTACAAAGG + Intergenic
900881690 1:5386271-5386293 GCTTTCCCCTGAATCTAAAGGGG + Intergenic
901717740 1:11170237-11170259 GCTTCCCAATGAACCTACAGTGG - Intronic
904090750 1:27943440-27943462 GCTGTCCACTGAATGTCCTGTGG + Intronic
904228309 1:29043779-29043801 GCTTTTCACTGACACTTCAATGG - Intronic
904353963 1:29926609-29926631 GCTCTCCCCTGAACCTCCAGGGG - Intergenic
907214821 1:52853562-52853584 GCTAGCCACTGAAAATACAGAGG - Intronic
909585748 1:77285736-77285758 GATATCCACTGAGATTCCAGAGG - Intronic
910728816 1:90368097-90368119 GCTCTCCAGTGATGCTCCAGTGG + Intergenic
911203543 1:95070390-95070412 GATTTTCAGTGAAACTTCAGAGG + Intronic
919095185 1:193025494-193025516 GCTTTCCACTCATACTGAAGTGG - Intronic
921503668 1:215939186-215939208 TCTTTCCACTGAAGATGCAGAGG + Intronic
921613951 1:217244785-217244807 CCCTGCCACTGAAACCCCAGAGG + Intergenic
921890628 1:220350146-220350168 TCTTCCCACTGAAAATGCAGGGG - Intergenic
922120829 1:222665628-222665650 TCTTTCCAATGAAACCTCAGAGG - Exonic
923402042 1:233624987-233625009 GATTTTCAGTGAAACTTCAGAGG - Intronic
923821906 1:237454082-237454104 GCTTTCCAATGAAAATCAACTGG + Intronic
1063063885 10:2589147-2589169 TCTTTCCAGTGAAAGTCCTGGGG + Intergenic
1063485713 10:6418590-6418612 CCTTTCCACCCAAACTCCTGTGG + Intergenic
1064315808 10:14255033-14255055 GCTTTCCACTGAAATGCCTGTGG + Intronic
1064647135 10:17471237-17471259 GATTTCCAGTGAACCTTCAGAGG + Intergenic
1065965618 10:30768051-30768073 GCTTTCCACTGGGGCTCCAGGGG - Intergenic
1070097479 10:73352023-73352045 GGTTTCCACTGATACCACAGTGG + Intronic
1070486500 10:76936950-76936972 GATTTGCATTGTAACTCCAGAGG - Intronic
1071217751 10:83427867-83427889 GATTTCCAGTGAACCTCCATGGG - Intergenic
1071385673 10:85118149-85118171 CATTTCCTCTGAAACTCCAATGG + Intergenic
1073676008 10:105647860-105647882 GTTTTTCACTGAAACTGCAGAGG + Intergenic
1075343643 10:121666603-121666625 GCCTTCCACTTAGACTCAAGGGG + Intergenic
1076037119 10:127209192-127209214 TCTTTACACTGAGATTCCAGTGG + Intronic
1076190478 10:128479765-128479787 TCTTTGGGCTGAAACTCCAGTGG - Intergenic
1077739214 11:4826474-4826496 GCTCTCCACTGAAACAACAATGG - Intronic
1078098669 11:8315893-8315915 GCTCTGCCCAGAAACTCCAGTGG + Intergenic
1078605418 11:12770959-12770981 GCTTTCCACAGATTCTCCAAGGG - Intronic
1078940245 11:15995255-15995277 GCTTTCCACTGAAACTCCAGAGG + Intronic
1082110805 11:48271710-48271732 GCTTGCTAATGAGACTCCAGGGG - Intergenic
1082781007 11:57287387-57287409 GCTTTCCAATGAAACTCCCAAGG + Intergenic
1085499592 11:77007548-77007570 GGTTTCCACTGACACCCAAGTGG + Intronic
1086231295 11:84573096-84573118 GCTACCCACTAAAAATCCAGTGG - Intronic
1086288371 11:85275113-85275135 GATTTTCAGTGAAACTTCAGAGG + Intronic
1086382881 11:86276001-86276023 GCTGTCCAGTAAAACTCTAGGGG + Intronic
1089600851 11:119614013-119614035 GCTTTCCATTGATTTTCCAGTGG + Intergenic
1090018461 11:123106308-123106330 GCTTTTCAATGAACCTTCAGCGG + Intronic
1091199420 11:133762594-133762616 GCTCTCCACTGACAGTGCAGTGG - Intergenic
1091915762 12:4271168-4271190 GCTTTACAGAGAAATTCCAGCGG - Intergenic
1095516032 12:43006536-43006558 GCTCTCCATTCAAACTTCAGGGG + Intergenic
1096416418 12:51418153-51418175 GCTCTCCTCTGTAACTCCAAAGG - Intronic
1097156944 12:57018898-57018920 GATTTTCACTGAAACTTTAGGGG + Intronic
1098108772 12:67099408-67099430 GATTTTCAGTGAAACTTCAGAGG + Intergenic
1098630545 12:72716574-72716596 GCTTCTCACTGAAACTGCAGAGG - Intergenic
1101080855 12:101182715-101182737 CTTTTCCACTGAAGCTACAGAGG - Intronic
1107599545 13:41999468-41999490 GCATCTCACTGAAACTTCAGAGG - Intergenic
1108111849 13:47082159-47082181 GCTTATCTCTGAAATTCCAGAGG + Intergenic
1109151674 13:58856365-58856387 GCTTACCTCTGAAGCCCCAGTGG + Intergenic
1111234685 13:85393399-85393421 TCTTTCCACTCAAAATCCAGAGG - Intergenic
1111292877 13:86190008-86190030 GATTTCCACTGAAAAGCCTGTGG + Intergenic
1112039861 13:95535986-95536008 CCTTTCCACTGAAACACCATAGG - Intronic
1113476004 13:110581914-110581936 GGTCTCCACTGACACTGCAGTGG + Intergenic
1116424829 14:44778294-44778316 GTTATTCACTGAAATTCCAGAGG + Intergenic
1120058273 14:79951021-79951043 GCTTTCAACAGGAACTGCAGAGG + Intergenic
1120378684 14:83744883-83744905 GCTTTCACCTGAGACTGCAGAGG - Intergenic
1121133086 14:91467345-91467367 GCTTTACATTGAAAATCCAATGG - Intronic
1121799176 14:96759120-96759142 GGTTTCCCCTGAACCTGCAGAGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123462054 15:20482097-20482119 GCTTGACACTGAAACTGAAGAGG + Intergenic
1123656002 15:22518275-22518297 GCTTGACACTGAAACTGAAGAGG - Intergenic
1124078690 15:26470871-26470893 GATTTTCACTGAACCTTCAGAGG - Intergenic
1124309911 15:28613456-28613478 GCTTGACACTGAAACTGAAGAGG - Intergenic
1128257190 15:66205639-66205661 GGTCTCCACTGACACTGCAGGGG - Intronic
1132646473 16:1001500-1001522 GCTCCCCAATGAGACTCCAGAGG + Intergenic
1133088388 16:3383615-3383637 GCTTTACAGAGAAAGTCCAGAGG - Exonic
1133474914 16:6111548-6111570 GCTTTGCTCTGTAACTCCAATGG - Intronic
1133959507 16:10480893-10480915 GCTTTCGAATGTGACTCCAGGGG - Exonic
1134189485 16:12110224-12110246 ACTTTCCCCTGAAGCTCCTGAGG + Intronic
1136492641 16:30619811-30619833 GCATTGAGCTGAAACTCCAGAGG + Intronic
1136999489 16:35216629-35216651 GCTGTCCTCTGGACCTCCAGGGG - Intergenic
1137003461 16:35251377-35251399 GCTGTCCTCTGGACCTCCAGGGG + Intergenic
1140718790 16:77751606-77751628 GCTTTCCACTGGAATTACAATGG - Intergenic
1141151597 16:81568207-81568229 CCTTTTCATTGCAACTCCAGGGG + Intronic
1141941318 16:87278029-87278051 ACGTTCCCCAGAAACTCCAGAGG + Intronic
1144115249 17:12082914-12082936 TCTTTCCACTTACACTGCAGTGG - Intronic
1144761451 17:17709749-17709771 GCTTTCCTCTGAACCTTAAGGGG + Intronic
1146129198 17:30256150-30256172 GCTTACCCCTGTAACCCCAGAGG - Intronic
1150443457 17:65210346-65210368 TTTTTCCAGTGAACCTCCAGTGG - Intronic
1155955239 18:31951357-31951379 GATTTTCAGTGAACCTCCAGGGG + Intronic
1161098106 19:2405436-2405458 GCTTGCCACGGAAACTCCCCCGG - Exonic
1164537112 19:29093996-29094018 GCGCTCCACTTTAACTCCAGAGG - Intergenic
1165679524 19:37761905-37761927 GATTTTCAGTGAAACTTCAGAGG + Intronic
1168576396 19:57514998-57515020 GCATTGAGCTGAAACTCCAGAGG - Intronic
925684663 2:6458776-6458798 GAGCTCCAGTGAAACTCCAGTGG + Intergenic
925847814 2:8049497-8049519 GCATTGCAATGAGACTCCAGAGG - Intergenic
928689392 2:33783378-33783400 GCTTTTCACAGCAACTACAGGGG + Intergenic
929337328 2:40765014-40765036 GATTTCCACTGAATTTCCAAGGG + Intergenic
931188169 2:59973804-59973826 CCTTTCCCCTGAAACTCCCCAGG + Intergenic
931635530 2:64337895-64337917 GCTTTCCCAGGAAACTACAGAGG - Intergenic
931763772 2:65437022-65437044 GTTGTAAACTGAAACTCCAGAGG - Intergenic
932609021 2:73184866-73184888 GCCTTCCACTGACACTTCTGTGG - Intergenic
933199213 2:79429715-79429737 GTTTTCAAATGAAACTCCAAGGG + Intronic
937802926 2:126101777-126101799 GCTTAGCACGGAAACTCCAAGGG - Intergenic
938587040 2:132701248-132701270 GGTTTCCACTGAAATACCACAGG + Intronic
938785286 2:134623088-134623110 GCTGTCCACTGAAAATCCTTAGG - Intronic
940648684 2:156418598-156418620 GATTTCCAGTGAACCTTCAGAGG - Intergenic
941451352 2:165664594-165664616 TCTTTCCACTGATCCTCCTGGGG + Intronic
943304418 2:186241948-186241970 GATTTTCACTGAATCTTCAGAGG + Intergenic
947528396 2:230893474-230893496 GCTGTGCACTGAAACTGCAGCGG - Intergenic
947601663 2:231454701-231454723 GCTCTCCAGTGACATTCCAGGGG + Exonic
948821955 2:240554403-240554425 GCTTGCCATGGAAAGTCCAGGGG - Intronic
1170067879 20:12334271-12334293 GCTTCCCCCAGAAACTCAAGAGG + Intergenic
1172970599 20:38870606-38870628 ACTTTGCACTGAACCACCAGAGG - Intronic
1177315892 21:19460395-19460417 AGTTTCCACTGAAACTAGAGAGG - Intergenic
1179418617 21:41217932-41217954 GCTTCCCACAGAAGCTCCAGGGG - Intronic
1180682747 22:17639764-17639786 GCTTTATACTAAACCTCCAGAGG - Intronic
1182292194 22:29288829-29288851 TCTTTCCACTGAAAATCCTATGG - Intronic
950046888 3:9953737-9953759 GCACTCCAGTGACACTCCAGTGG - Intergenic
951811802 3:26708866-26708888 GCTTTTAACTGAATTTCCAGAGG - Intronic
952532959 3:34280783-34280805 GCTTTCCCCTGCCACACCAGAGG - Intergenic
955883421 3:63572076-63572098 GCTTTGGACTGAAAGTCAAGTGG - Intronic
957991089 3:87628094-87628116 GTTTACAACTGAAGCTCCAGTGG - Intergenic
959295493 3:104530080-104530102 GATTTTCAGTGAACCTCCAGGGG + Intergenic
960109081 3:113827851-113827873 GTTTTCCCCTGAAACTTGAGAGG + Intergenic
962465081 3:135650212-135650234 GCTTTCCACTGCTAGTCAAGAGG - Intergenic
962891436 3:139676546-139676568 GCTTTCCCCTGCAAGGCCAGTGG + Intronic
963476197 3:145807743-145807765 ACTTTCCACTTAGACTCCTGAGG - Intergenic
963545915 3:146658421-146658443 GCTTTTCACACAAACTCCATGGG - Intergenic
963982459 3:151554783-151554805 ATATTTCACTGAAACTCCAGAGG - Intergenic
964310296 3:155385152-155385174 CCTGGCCTCTGAAACTCCAGAGG - Intronic
965080746 3:164028154-164028176 ACTTTTCAGTGAAACTTCAGAGG - Intergenic
966635479 3:182128610-182128632 GCTTTGCTCTGGAAGTCCAGAGG - Intergenic
967317510 3:188163214-188163236 GCTTTCCATTTGAACTACAGAGG - Intronic
968520490 4:1032759-1032781 CCTACCCACTGTAACTCCAGGGG - Intergenic
973216658 4:47676594-47676616 GCTTACCACTGAATTCCCAGGGG + Intronic
974318719 4:60315596-60315618 GGTCTCCACTGACACTACAGTGG - Intergenic
975463974 4:74688452-74688474 GGTTTCCACTGATACTGCAGGGG + Intergenic
978053263 4:104230351-104230373 GCTTTCCAGTGAATCTAAAGAGG + Intergenic
979797467 4:124864111-124864133 GATTTTCAGTGAACCTCCAGAGG + Intergenic
980984027 4:139678172-139678194 GATTTTCAGTGAACCTCCAGGGG + Intronic
982670589 4:158315696-158315718 GTTTACCACTGAATATCCAGAGG + Intronic
985051645 4:185997904-185997926 CACTTCCACTCAAACTCCAGTGG + Intergenic
987613700 5:20243978-20244000 ATTTTCAACTGAAAGTCCAGAGG - Intronic
989091131 5:37733115-37733137 ACTTTCTACAGAGACTCCAGGGG + Intronic
990043207 5:51397145-51397167 GCATTGCGCTGAAACTACAGGGG - Intergenic
992261161 5:74971636-74971658 TCTTTCCCCTGAAGCTTCAGTGG + Intergenic
992796751 5:80260451-80260473 GATTTTCAGTGAAACTTCAGAGG + Intergenic
993042669 5:82833217-82833239 GATTTTCAGTGAAACTTCAGAGG - Intergenic
993345892 5:86782174-86782196 GTTTTCCTCTGAAATTTCAGAGG + Intergenic
994183321 5:96791339-96791361 TGTTTCCATTGAAAGTCCAGGGG - Intronic
995350354 5:111167866-111167888 GGTTTCCACTGAAACTCGAGTGG + Intergenic
995521761 5:113014010-113014032 TCCTTTCACTAAAACTCCAGAGG - Exonic
997615713 5:135244903-135244925 ACTTTGGGCTGAAACTCCAGGGG - Intronic
997706975 5:135964837-135964859 TCTTTCCACTGAAACACAGGAGG - Intergenic
1003340206 6:5213381-5213403 GCTTTCCACTCATTCTTCAGAGG - Intronic
1008016155 6:46522228-46522250 TTTTCCCACTGAATCTCCAGAGG + Intergenic
1011562555 6:88636173-88636195 GCTTTCCAATGAAGTTCCAGGGG - Intronic
1012084099 6:94801251-94801273 CCTTTTCACTCAAACTCCAAAGG + Intergenic
1013944371 6:115704379-115704401 GCTTTCTACTGCATCTGCAGGGG + Intergenic
1014811996 6:125897317-125897339 GCTTTCCATTGAATATCCTGGGG - Intronic
1015499858 6:133920838-133920860 GCTTTCCCCTTAAACCCTAGAGG - Intergenic
1016522284 6:144959920-144959942 GCTTTCCTTTGCATCTCCAGGGG + Intergenic
1019258051 7:64229-64251 GCTTTCCTCTTCACCTCCAGAGG + Intergenic
1020495608 7:8849184-8849206 ACTTCCCACTGAAAATCAAGGGG - Intergenic
1020764056 7:12299151-12299173 ACTTTTCAGTGAAACTTCAGAGG - Intergenic
1027949222 7:84792377-84792399 ATGTTCCACTGAGACTCCAGGGG + Intergenic
1032547581 7:132756482-132756504 GCTTTACACTGAATCTCTGGCGG - Intergenic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1035062186 7:156077776-156077798 GCTTTTCACTGCAACGCCATTGG - Intergenic
1035829193 8:2676231-2676253 GCTTTCCACTAAAATTACAAAGG + Intergenic
1037573558 8:20179531-20179553 TCTTACCACTGAAACTCAAGGGG + Intronic
1038396397 8:27248756-27248778 GCTTTCCAATGAAACACATGAGG - Intronic
1039184980 8:34906612-34906634 ACTTTTCAGTGAAACTTCAGAGG + Intergenic
1043011521 8:74887343-74887365 ACTTTCCACTGAAACCCCCGAGG - Intergenic
1043515711 8:80993028-80993050 GCTTTCCACAGAAACTCTTCTGG + Intronic
1045430589 8:102111224-102111246 GCTTTCCCAAGAAACTTCAGAGG + Intronic
1046449118 8:114364560-114364582 GCTTTCCACTGAAAAGCCTGTGG - Intergenic
1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG + Intergenic
1050695010 9:8269046-8269068 GCTATCCCCTGGAACTACAGAGG + Intergenic
1051252459 9:15175128-15175150 GCTTTTCACTGAAAGAGCAGAGG + Exonic
1052036700 9:23689989-23690011 GCTTTCCACTAAAACTCTCAGGG + Intergenic
1053012870 9:34645067-34645089 GCATTCCACTGAAGCCTCAGAGG + Intronic
1055178251 9:73348380-73348402 TCATGCCACTTAAACTCCAGTGG + Intergenic
1055293071 9:74804335-74804357 TATCTCCACTGGAACTCCAGTGG + Intronic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1186154462 X:6711080-6711102 GATTTTCAGTGAAACTTCAGAGG - Intergenic
1186180441 X:6968174-6968196 ATTTTCCAGTGAAACTTCAGGGG + Intergenic
1186725654 X:12355813-12355835 GATTTCCAGTGAATCTTCAGAGG - Intronic
1187313905 X:18174048-18174070 ACCTTCCACTGATAATCCAGAGG - Exonic
1188406772 X:29820837-29820859 GTTTTCCACTGATACACTAGTGG + Intronic
1189490196 X:41465464-41465486 GCTTTCCACTGAAACCCCAAAGG - Intronic
1190451159 X:50582024-50582046 ACTTCCCACTTACACTCCAGGGG - Intergenic
1190722400 X:53160836-53160858 GCTTTGAGCTGAAACCCCAGAGG + Intergenic
1192149750 X:68704955-68704977 ACTTTCCACTCAAACCACAGTGG + Intronic
1194694622 X:97030784-97030806 ACATTTCACTGAAAATCCAGAGG - Intronic
1195004538 X:100672881-100672903 GATTTCCACTAAAATCCCAGTGG - Intergenic
1197178587 X:123510486-123510508 GCCTTGCCCTAAAACTCCAGGGG - Intergenic
1197597846 X:128488627-128488649 GTTTTCCAGTGACAATCCAGTGG - Intergenic
1198509410 X:137334580-137334602 GCTCTCCACTGAAACTCCTCAGG + Intergenic
1198691947 X:139293950-139293972 GGTTGGCACTGAAACTACAGTGG + Intergenic
1201465961 Y:14281374-14281396 GCATTCCATTCTAACTCCAGAGG + Intergenic
1201548576 Y:15194447-15194469 GATTTTCAGTGAAACTTCAGAGG - Intergenic