ID: 1078941531

View in Genome Browser
Species Human (GRCh38)
Location 11:16011791-16011813
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078941531_1078941536 -4 Left 1078941531 11:16011791-16011813 CCAGAGGAAACCTGTATGGACTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1078941536 11:16011810-16011832 ACTGAGGGAGAAGACATCCTGGG 0: 1
1: 0
2: 1
3: 20
4: 259
1078941531_1078941537 3 Left 1078941531 11:16011791-16011813 CCAGAGGAAACCTGTATGGACTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1078941537 11:16011817-16011839 GAGAAGACATCCTGGGCCAGAGG 0: 1
1: 0
2: 3
3: 19
4: 286
1078941531_1078941535 -5 Left 1078941531 11:16011791-16011813 CCAGAGGAAACCTGTATGGACTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1078941535 11:16011809-16011831 GACTGAGGGAGAAGACATCCTGG 0: 1
1: 0
2: 1
3: 14
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078941531 Original CRISPR CAGTCCATACAGGTTTCCTC TGG (reversed) Intronic