ID: 1078944087

View in Genome Browser
Species Human (GRCh38)
Location 11:16044184-16044206
Sequence ATTTGGGTTTCCTGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078944087_1078944096 26 Left 1078944087 11:16044184-16044206 CCTGTTTCCCAGGAAACCCAAAT 0: 1
1: 0
2: 1
3: 23
4: 312
Right 1078944096 11:16044233-16044255 GTCCAAATGAGGGAGAGAAGAGG 0: 1
1: 0
2: 0
3: 24
4: 339
1078944087_1078944095 16 Left 1078944087 11:16044184-16044206 CCTGTTTCCCAGGAAACCCAAAT 0: 1
1: 0
2: 1
3: 23
4: 312
Right 1078944095 11:16044223-16044245 TGCAAAGAGTGTCCAAATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 163
1078944087_1078944094 15 Left 1078944087 11:16044184-16044206 CCTGTTTCCCAGGAAACCCAAAT 0: 1
1: 0
2: 1
3: 23
4: 312
Right 1078944094 11:16044222-16044244 CTGCAAAGAGTGTCCAAATGAGG 0: 1
1: 0
2: 2
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078944087 Original CRISPR ATTTGGGTTTCCTGGGAAAC AGG (reversed) Intronic
901229625 1:7634508-7634530 ATCTGGGTGTCCTGGGAATCTGG + Intronic
901413649 1:9102451-9102473 TTTTTGGTTTCCTGTGAAAATGG - Exonic
902509703 1:16959586-16959608 AGATGGGTTTCCAGTGAAACTGG + Intronic
902631507 1:17707271-17707293 GTTGGGGGTTGCTGGGAAACAGG - Intergenic
906067904 1:42995370-42995392 ATTTGGGTTTTTTTGGATACAGG + Intergenic
906319704 1:44808461-44808483 CTGTGGGTTTCCATGGAAACTGG - Exonic
906333365 1:44906890-44906912 ATTTGGGGATCCAGGTAAACAGG - Intronic
906657370 1:47558516-47558538 ATTTGGCATTCCTGGGCAAGAGG - Intergenic
908961600 1:69704076-69704098 ATTTGTGGTTCCTGGAAGACAGG - Intronic
911068394 1:93812501-93812523 ATTTGGGTTTCCCAGGGAAATGG - Intronic
913372260 1:118113709-118113731 ATTTGAGAGTCCTGGGTAACTGG - Intronic
915516924 1:156418905-156418927 ATTTGGGTTTTCTGGGGGAGGGG - Intronic
917062519 1:171056174-171056196 ATTTGAGCTTCTTGGGAAAGGGG + Intronic
917621342 1:176799801-176799823 ATTTCGGTATCTTGGGAAAGAGG + Intronic
917839596 1:178966930-178966952 AATTGGGTTTCCTGCCAAGCTGG + Intergenic
918247937 1:182676479-182676501 TTTAGGGTTTCCATGGAAACCGG + Intronic
918822841 1:189280090-189280112 AATTGGTATTCCTGGTAAACTGG - Intergenic
922178011 1:223212069-223212091 CTTTGGGTTTTCTGGGTATCTGG - Intergenic
923372257 1:233326871-233326893 CTGTGGGTTTCCAGGGAGACTGG + Intergenic
923467373 1:234261336-234261358 ATTTGAGTTTTCTGGGAAAGGGG + Intronic
923998626 1:239525897-239525919 ATTGGGGTGTCCTGGGCATCAGG - Intronic
1062930282 10:1348324-1348346 ATGTGGGTTTCCTGGGTGAGCGG + Intronic
1063933189 10:11050107-11050129 CTCTGGGTTTCCTGACAAACTGG + Intronic
1065975222 10:30835882-30835904 ATGTGGGCTTCCTAGGAAAGCGG + Intronic
1066239652 10:33521209-33521231 GTTTGGGTTTCCTCGGAGTCTGG + Intergenic
1066287045 10:33978327-33978349 ATTTCGGTTTCCTCAGAAACAGG - Intergenic
1066307925 10:34165129-34165151 ATTTGGGTCTCTGGAGAAACGGG + Intronic
1068205853 10:53852126-53852148 ATTTGAGTTTCATGGTGAACTGG + Intronic
1069834458 10:71299863-71299885 GTTTGCGTTTCCTAAGAAACTGG - Exonic
1070284491 10:75073091-75073113 TTTTGTGTTACCTGGGACACAGG + Intergenic
1070463022 10:76688801-76688823 TGTTGGGGTTCCTGGGAAAGAGG + Intergenic
1070488098 10:76950439-76950461 ATTTGTATTTCCTGGGAAGTTGG - Intronic
1071879940 10:89886100-89886122 GTTTTGGTTTGGTGGGAAACAGG + Intergenic
1073725835 10:106229471-106229493 ATTTGGGTTTCCAGATAAGCAGG + Intergenic
1074456688 10:113601816-113601838 CTTTGGGATTCTTGGGAAAATGG - Intronic
1075336847 10:121614891-121614913 ATTTGGATTGGCTGGGAAAAGGG - Intergenic
1075806108 10:125190161-125190183 TTTTGGGTTTCCCGGGAGAACGG + Intergenic
1077496570 11:2889624-2889646 ATTTGGGTTCCCTGGGGCTCTGG - Intronic
1077905543 11:6530050-6530072 ATTTGGGAGTTGTGGGAAACTGG + Intronic
1078088138 11:8246997-8247019 GTTTGAGTTTCCTGGGGAGCAGG - Intronic
1078572345 11:12470130-12470152 ATTTTGTTTTTCTGGGAAAAAGG + Intronic
1078944087 11:16044184-16044206 ATTTGGGTTTCCTGGGAAACAGG - Intronic
1079043325 11:17078431-17078453 ATTTGAATTTCATGGGAAAAGGG + Intronic
1079465694 11:20727821-20727843 ATTTGAGGTTCCGGGAAAACTGG - Intronic
1079820443 11:25120730-25120752 TTTTGGGTTTCTTGGTAAATGGG + Intergenic
1080275976 11:30503875-30503897 ATTTGATTTTCCTGGGCACCTGG - Intronic
1082234313 11:49804420-49804442 AGTTTAGTTTCCTGGGAAAATGG - Intergenic
1082347622 11:51457659-51457681 TTGTGGCTTTCCTTGGAAACGGG + Intergenic
1082483341 11:53424216-53424238 TTTTGGCCTTCCTTGGAAACGGG + Intergenic
1082510060 11:53810096-53810118 CTTTGGATTTCGTTGGAAACGGG + Intergenic
1082533955 11:54155635-54155657 ATTTGGCCTTCCTTCGAAACGGG + Intergenic
1084445945 11:69203889-69203911 TTTTGGGGTCCCTGGGAAGCTGG + Intergenic
1084901173 11:72311041-72311063 ATGTGGGTCCCCTGTGAAACAGG + Intronic
1084994754 11:72965306-72965328 ATTTAGTTTTCCTGGAAGACAGG - Intronic
1085161508 11:74351560-74351582 ATCTAGGTTTACTGGGAAACTGG - Exonic
1085985226 11:81778948-81778970 ATGTGGGCTTCCTGGAAAAACGG + Intergenic
1087362360 11:97177143-97177165 CTTTGTGTTTCCTGGTTAACAGG + Intergenic
1088921954 11:114266065-114266087 ATTTGGGTTTTCTTGGATATAGG - Intronic
1089087306 11:115832510-115832532 ATTTGCGTTTTTTGAGAAACTGG - Intergenic
1089968305 11:122671982-122672004 AATGGGTTGTCCTGGGAAACAGG + Intronic
1090097327 11:123755513-123755535 ATGTGGGTTTCCTTTGAAATGGG + Intergenic
1091406440 12:212438-212460 ATTTGGGTTTCATCAGAAATAGG + Intronic
1092667849 12:10824963-10824985 CTTTGGGTTTTCTGGGAGAATGG + Intronic
1094027265 12:25971930-25971952 CTTTGGGTCTCCTGGAAAGCAGG + Intronic
1094841858 12:34345620-34345642 GCGTGGGTTGCCTGGGAAACTGG - Intergenic
1097749009 12:63331262-63331284 AGTTGGGTGGCATGGGAAACAGG - Intergenic
1097992323 12:65848911-65848933 ATTTGGGTTTTCTGGGAACTTGG - Intronic
1098165617 12:67694630-67694652 AGTTGGCTTAGCTGGGAAACAGG - Intergenic
1098221230 12:68271956-68271978 ATTTTGGTTTCCTGTGACACTGG - Intergenic
1098957928 12:76706633-76706655 ATTTAGGTTTTCTGGAAGACAGG - Intergenic
1099210758 12:79785135-79785157 ATTTAGGCTTCATGGTAAACTGG - Intronic
1100730738 12:97465102-97465124 AGTTGGGGTGCCTGTGAAACCGG + Intergenic
1100817405 12:98399339-98399361 ATTTGGGATTGCTGTGAGACAGG + Intergenic
1101752173 12:107590807-107590829 GATTTGGCTTCCTGGGAAACAGG + Intronic
1103462650 12:121117375-121117397 CTTTGGGTTTCCAGGGGATCTGG - Intergenic
1103635118 12:122298179-122298201 GGTTGAGTTCCCTGGGAAACAGG - Intronic
1103674310 12:122643663-122643685 CTTGGGGTTTCCTGGGTAATAGG - Intergenic
1104272222 12:127292899-127292921 CCTTGAGTATCCTGGGAAACTGG + Intergenic
1105145923 13:17186397-17186419 ATCAGGATTTCCTTGGAAACGGG + Intergenic
1105158466 13:17391107-17391129 ATCAGGATTTCCTTGGAAACGGG + Intergenic
1105340900 13:19524458-19524480 CTTTGGGTATCCTGAGAGACTGG - Intronic
1107124774 13:36834814-36834836 ATTAGCGTTTCCTGGAATACTGG + Intergenic
1111519130 13:89376894-89376916 ATTTGGGCTTCTTGGTAAAATGG - Intergenic
1111911515 13:94317543-94317565 ATTTGATTTTCCTGAGTAACTGG - Intronic
1113404841 13:110029124-110029146 ATGAGGGTTTCCTAGAAAACGGG + Intergenic
1113629785 13:111874405-111874427 ATGTTGGTTTCCTGGGACCCAGG + Intergenic
1114538908 14:23440482-23440504 ATTTTGCTGTCCTGGGAAACAGG - Intergenic
1116023210 14:39486022-39486044 AATTGGTTTTCCTGGAAAAGGGG - Intergenic
1116371143 14:44134528-44134550 ACTTGGGTAACCTGAGAAACAGG - Intergenic
1117823932 14:59680514-59680536 ATTTGGGTTCATTGGGAAATTGG - Intronic
1118677734 14:68206764-68206786 ACTGGGGTTTCTTGGGAAAATGG - Intronic
1120107887 14:80516976-80516998 ATTTGGTTTTCCTGAGAGATAGG + Intronic
1120895305 14:89525474-89525496 ACATGGGTTTTCTGGGAAAGGGG - Intronic
1122723792 14:103737126-103737148 ATTTTGTTTTCTTGGGAATCTGG + Intronic
1124545214 15:30620526-30620548 AGTTGGGTTGCCTGAAAAACAGG + Intergenic
1124778739 15:32609918-32609940 AGTTGGGTTGCCTGAAAAACAGG + Intergenic
1127591039 15:60423701-60423723 CTTTTGGTTTCCATGGAAACTGG + Exonic
1129342009 15:74892387-74892409 ATTTGGGTTTCCTGATTCACAGG + Intronic
1130912121 15:88277881-88277903 ACTTGGCTTTCTTGGGAATCAGG - Intergenic
1131027395 15:89155975-89155997 ATTTTAGGTTCCTGGGGAACAGG + Intronic
1132231599 15:100188521-100188543 ATTGGGGTTTCCCGTGAAATGGG - Intronic
1132279948 15:100603436-100603458 TTTTGTTTTTCCTGGGAAACTGG - Intronic
1132650198 16:1017778-1017800 ATTTGGGTTTCCCGGGTGGCTGG + Intergenic
1134367928 16:13596551-13596573 TTTGGGGTTTCCCAGGAAACGGG - Intergenic
1134381568 16:13732020-13732042 ATTTGTGTTTACTAGGAAGCAGG + Intergenic
1135873951 16:26179642-26179664 TTTTGGGTTTTATGGGGAACAGG + Intergenic
1136088138 16:27900167-27900189 ATTTGGGGTTCCTGGAGGACTGG - Intronic
1138897076 16:61219822-61219844 ATTTGTGTTGACTGAGAAACTGG + Intergenic
1139275214 16:65721063-65721085 ATTGATGATTCCTGGGAAACTGG - Intergenic
1140388846 16:74567437-74567459 ATTGGGGTTTCCTAGGACACAGG + Intronic
1140694001 16:77513816-77513838 ATTTGGCTATCCTGTGAAATAGG - Intergenic
1141033157 16:80607005-80607027 AATAGGGTTTCCTGGGATGCAGG + Intronic
1141335646 16:83152766-83152788 ATGTGGCTTTCCTTGGAAATAGG + Intronic
1141365365 16:83437755-83437777 ATCTGGGGTTCATGGGAAAAGGG - Intronic
1141488693 16:84357353-84357375 ATTTTGCTGTCCTGGGAGACAGG - Intergenic
1141580527 16:84995261-84995283 CTTTTGGTGTTCTGGGAAACAGG - Intronic
1141998275 16:87648574-87648596 AGTGGGTTTTCCTGGAAAACGGG + Intronic
1142957976 17:3534181-3534203 GTGTGGGTGTCCTGGAAAACGGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144611550 17:16722906-16722928 ATCTTGGTTTCTTGAGAAACTGG + Intronic
1144901191 17:18592444-18592466 ATCTTGGTTTCTTGAGAAACTGG - Intergenic
1145418713 17:22748037-22748059 ATTTGGCCTTCCTTCGAAACGGG + Intergenic
1146785334 17:35715480-35715502 TTTTGGGTTTCCTGGGAAATGGG + Intronic
1148404673 17:47400483-47400505 ATTTGGGTCCCTTGGTAAACAGG + Intronic
1148476957 17:47935034-47935056 AGTTGGGTTTCCTAGGAGAAGGG + Intergenic
1151393793 17:73805839-73805861 ATTTGGGTGTCCTTGGCATCTGG + Intergenic
1152041513 17:77906692-77906714 GTTTGGGCTTCCTGGGGAGCAGG - Intergenic
1154630042 18:16774594-16774616 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154639300 18:16901306-16901328 TTTAGGATTTCGTGGGAAACGGG + Intergenic
1154645888 18:16992072-16992094 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154756692 18:18510575-18510597 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154759928 18:18554486-18554508 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1154767191 18:18654378-18654400 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154768707 18:18675067-18675089 TTGTGGATTTCGTGGGAAACGGG + Intergenic
1154776163 18:18777367-18777389 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154777226 18:18791947-18791969 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1154802962 18:19145892-19145914 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154873245 18:20114921-20114943 ATGAGGATTTCGTGGGAAACGGG + Intergenic
1154908389 18:20609658-20609680 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154908910 18:20617824-20617846 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154909526 18:20627470-20627492 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154910188 18:20637845-20637867 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154910539 18:20643342-20643364 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154910728 18:20646407-20646429 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154911311 18:20655541-20655563 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154912164 18:20668985-20669007 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154912355 18:20672050-20672072 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154912640 18:20676474-20676496 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154913007 18:20682439-20682461 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154913677 18:20692832-20692854 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154913865 18:20695898-20695920 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154923219 18:20840598-20840620 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154923425 18:20844000-20844022 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154923631 18:20847403-20847425 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154923883 18:20851289-20851311 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154924090 18:20854690-20854712 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154924338 18:20858609-20858631 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154925206 18:20922431-20922453 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1154925731 18:20930592-20930614 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1158772926 18:60543508-60543530 GGTTGAGTTTCCTGGGAAATGGG + Intergenic
1158933119 18:62340222-62340244 TTTTGGGTTTTCTTTGAAACAGG + Intronic
1159329099 18:66965917-66965939 AATTGGTTTTCCTAAGAAACTGG - Intergenic
1159681082 18:71353195-71353217 TTTTCGTTGTCCTGGGAAACTGG + Intergenic
1159803900 18:72931322-72931344 ATTTAAGTTTCCTGGCAACCAGG + Intergenic
1160976930 19:1797223-1797245 TTTTGGGGTCCCTGGGAGACAGG - Intronic
1160976947 19:1797275-1797297 TTTTGGGGTCCCTGGGAGACGGG - Intronic
1160976977 19:1797366-1797388 TTTTGGGGTCCCTGGGAGACAGG - Intronic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
926622826 2:15062466-15062488 ATTTGGATTTCATGCCAAACTGG - Intergenic
927142878 2:20141676-20141698 ATCAGGGTTTGCTGGGAAAGGGG - Intergenic
928064365 2:28148444-28148466 AGTTGGGTTACCAAGGAAACTGG + Intronic
930050419 2:47211451-47211473 GTCAGGGTTTCCTGGGTAACTGG + Intergenic
930190344 2:48452639-48452661 ATTTGGATTTCCTGTGTTACAGG + Intronic
931265137 2:60653790-60653812 ATTTAGATTTCCTGGGAACTCGG + Intergenic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
931996670 2:67845536-67845558 AGTGGGTTTTCCTGGGAAGCAGG - Intergenic
932728975 2:74204289-74204311 ATTTGGGTTTCATGGAACCCAGG + Intronic
932983566 2:76698742-76698764 ATCTGGGTTGCCTGGGCAAAAGG - Intergenic
933766583 2:85713325-85713347 TGTAGGGTTTCCTGGGACACAGG - Intergenic
934469472 2:94505262-94505284 TTTAGGGTTTCGTTGGAAACGGG - Intergenic
934668489 2:96191157-96191179 TTTTGGGTTTTTTTGGAAACAGG - Intronic
934979824 2:98830612-98830634 ATTTTGGTTTCCTATGAAGCTGG + Intronic
935537956 2:104316399-104316421 TGTGGGGTTTCCTGGGAATCTGG + Intergenic
936284422 2:111171352-111171374 ATTTGCTTTTTCTGGGAAAGAGG + Intergenic
936609389 2:113987279-113987301 ATTTGGGTTACGTGGAAATCAGG - Intergenic
937563270 2:123251401-123251423 ATTTTTGTGTCTTGGGAAACAGG + Intergenic
938535520 2:132238272-132238294 ATTTGGATTTCTTTGGAAACAGG + Intronic
938760221 2:134418556-134418578 ATTTGGAGCTCCTGGAAAACAGG - Intronic
940021706 2:149162957-149162979 ATTTCTGTTTTCTGGGCAACTGG + Intronic
940779537 2:157918215-157918237 ATATGAGTTACCTGGGAAAGAGG - Intronic
940858690 2:158750423-158750445 TTTGGGGTTTCCTGGGACATGGG + Intergenic
940980002 2:159990867-159990889 ATTTGGGTCTACTGTGAGACAGG + Intronic
941125063 2:161575367-161575389 ATTTGGGTTTGTTGGGGAAATGG + Intronic
942051589 2:172145894-172145916 ATGTGGCTTTCCCAGGAAACAGG - Intergenic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
945909017 2:215625324-215625346 ATCTGGGGTTCCAGGGAAACTGG - Intergenic
946106235 2:217372381-217372403 ATTTGGGGCCCCTGGGAAACAGG + Intronic
947231995 2:227897328-227897350 ATATGGGTGTCCTGGGACAAGGG + Intronic
947474506 2:230430844-230430866 ATTTGGACTTCCTGGTTAACAGG + Intronic
947825247 2:233101278-233101300 TCTTGGGGTTCCTGGAAAACTGG + Intronic
947847617 2:233258112-233258134 ATTTGTGTTTACTGGGTCACTGG + Intronic
948426028 2:237887002-237887024 ACTTGGCTGTCCTGGGACACAGG + Intronic
948519424 2:238526172-238526194 CATGGGGTTTCCTGGGATACTGG + Intergenic
948890816 2:240906267-240906289 AGCTGGGTTTCCCTGGAAACAGG - Intergenic
1170955064 20:20972404-20972426 AGCTGAGCTTCCTGGGAAACGGG - Intergenic
1171581391 20:26460631-26460653 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1171587247 20:26542878-26542900 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1171609978 20:26886519-26886541 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171610957 20:26901133-26901155 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171670810 20:27798502-27798524 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171690576 20:28094794-28094816 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171695212 20:28163811-28163833 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171706537 20:28334958-28334980 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1172511973 20:35507123-35507145 ATGTGGGTTGCCTGGGAGAGAGG - Intronic
1173223528 20:41147954-41147976 CTTTTTGCTTCCTGGGAAACAGG - Intronic
1173808371 20:45940855-45940877 CGTTGGGGTTCCTGGGATACTGG - Exonic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1174802914 20:53580135-53580157 TTTTGAGTTTCCTGGGACACAGG - Intronic
1174951600 20:55047738-55047760 ATTTGGGTTACCTGGGGATATGG + Intergenic
1179418636 21:41218089-41218111 ATTCAAGTTTCCTGGAAAACGGG - Intronic
1179442680 21:41406326-41406348 TCCTGGGATTCCTGGGAAACAGG + Intronic
1180503582 22:15965852-15965874 TTTTGGATTTCATTGGAAACGGG + Intergenic
1183000739 22:34856578-34856600 GTATGGGTTTTCTGGCAAACAGG + Intergenic
1183109457 22:35638322-35638344 ATGTGAGTTTACTTGGAAACAGG - Intergenic
1183577641 22:38701824-38701846 TTTTGGGTTTTCTGTAAAACTGG + Intergenic
1203334993 22_KI270739v1_random:56660-56682 TTTTGGATTTCATTGGAAACGGG - Intergenic
949887429 3:8707387-8707409 TTTTGGGTTCCCTGGGACCCAGG - Intronic
950055808 3:10023529-10023551 ATTGGGGTTTCCTGGGGACAAGG - Intergenic
950921959 3:16703863-16703885 ATTTGTGTTACCTGGAAAGCAGG - Intergenic
951582410 3:24180022-24180044 GAATGGGTTTCCAGGGAAACAGG - Intronic
954333619 3:49903753-49903775 ATTTGGGTTTCACAGGAACCTGG - Intronic
958196801 3:90251634-90251656 ATCTGGGTTTCCGGAGAAATAGG + Intergenic
958601249 3:96299281-96299303 ATTTTGGGTTCCTGGGCAAGAGG + Intergenic
959108271 3:102091315-102091337 GCTTGGGTTTCCTTGTAAACAGG - Intergenic
961514238 3:127422905-127422927 GGCTGGGTTTCCTAGGAAACAGG + Intergenic
965036435 3:163444916-163444938 CTTTGTGTTTCAAGGGAAACAGG - Intergenic
965330975 3:167374353-167374375 AATTGGGATACTTGGGAAACAGG - Intronic
967988585 3:195114469-195114491 ATTTGGGTCTCATGGGACCCAGG - Intronic
968826812 4:2904317-2904339 TTTTGGTTGTCCTGGGAGACAGG - Intronic
972275168 4:37550435-37550457 ATTTGGACTTACTTGGAAACAGG + Intronic
972607933 4:40630722-40630744 ATCTGGGTTTCTTGGGAATTGGG - Intronic
973432128 4:50168726-50168748 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973461099 4:50647540-50647562 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973499843 4:51287226-51287248 TTTTGGATTTCGTTGGAAACGGG + Intergenic
973513862 4:51517672-51517694 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
974113602 4:57554263-57554285 ACATAGGTTTCCTTGGAAACTGG - Intergenic
974410372 4:61533419-61533441 ATATATATTTCCTGGGAAACTGG + Intronic
978399613 4:108316754-108316776 GGTTGGGTTCCCTGGGAAACAGG + Intergenic
980864904 4:138542867-138542889 ATTTGGGTGGCATGGGGAACAGG - Intergenic
982024240 4:151235876-151235898 ACTTTGGTTTCCTGGGAGAGTGG - Intronic
983300455 4:165918835-165918857 ATTTGGATTTCCTGAAACACTGG + Intronic
984100710 4:175482098-175482120 ATGTGGCTTTACTTGGAAACAGG - Intergenic
984129466 4:175856119-175856141 ATGTGGTTTTCCTGGGTAAAAGG + Intronic
987525424 5:19044332-19044354 ATTTGTGTTTCCAGGGATACAGG - Intergenic
988652371 5:33166798-33166820 ATTTGGGTTTCTTAGGCAATTGG + Intergenic
989525053 5:42443580-42443602 ATTAGGGTTTCCAGAGAAACAGG + Intronic
989960830 5:50412914-50412936 ATCTGGGATTTCTGGGATACTGG + Intronic
990256382 5:53975066-53975088 ATGTTGGTTTCCTGGTAATCAGG - Intronic
991601254 5:68353534-68353556 ATGTGGGTTTTCTGTGAGACAGG + Intergenic
992199377 5:74368716-74368738 ATTAGGATTTCCAGGGAAACTGG + Intergenic
992269217 5:75049071-75049093 ATGTGGATTTACTGAGAAACAGG - Intergenic
993500521 5:88661091-88661113 ATTGGTGTTTCCCGGGAGACGGG - Intergenic
993760277 5:91786407-91786429 ATTTGGGCTTCCTCAGGAACAGG - Intergenic
995086509 5:108117182-108117204 ATTTGGCTTTCATGTGAAAGTGG + Intronic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
998944859 5:147327605-147327627 CTTAGGGTTTCCTGGGTACCAGG + Intronic
999993414 5:157069197-157069219 TTTTGGATTTCCTGAGAAATTGG - Intergenic
1000782493 5:165499757-165499779 ATATGGGTTTCCTGAGCACCTGG + Intergenic
1002788219 6:419642-419664 ATTTGGGGTTGCCTGGAAACAGG + Intergenic
1005070197 6:21855210-21855232 ATTTGGAATTCCTGGAACACAGG + Intergenic
1005170673 6:22980968-22980990 AGTTGGGTGGCATGGGAAACAGG - Intergenic
1005522600 6:26613775-26613797 ATTTGGGTTCCCGGGCACACGGG + Intergenic
1006900942 6:37500622-37500644 GTTTTGGTTTCATGGGTAACTGG - Intergenic
1007406912 6:41640542-41640564 GTTTGGGCTTCCTGGGCAGCAGG - Intronic
1008445457 6:51584443-51584465 TGTTGAGTTTCCTGGGATACAGG + Intergenic
1008679238 6:53855089-53855111 ATTTGGGCTTCCTGGTACCCAGG + Intronic
1009313755 6:62190975-62190997 ATATGGATTTTCAGGGAAACTGG - Intronic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1010987743 6:82444676-82444698 ATTTAGGTTTTCTGGGAAGAGGG - Intergenic
1011274051 6:85611412-85611434 ATTTGCATTTACTGGGGAACTGG + Intronic
1011685273 6:89818878-89818900 ATTAGAGTTTTCTGGGAAATAGG - Intronic
1012480576 6:99662548-99662570 ATTGGGGTTTTCTGGGAAGCTGG + Intergenic
1014710273 6:124798437-124798459 GTTTTGGTTTAGTGGGAAACTGG - Intronic
1014752506 6:125270720-125270742 TTGTGGGCTTCCTGGGATACTGG + Intronic
1017866205 6:158445530-158445552 CTTTTGGTTTACTGGGAGACAGG + Intronic
1022311007 7:29195375-29195397 ATTTGGGTGTCCAGGGTAGCGGG - Intronic
1023361062 7:39415349-39415371 ATTTCGTTTTCCTGGGAATTGGG + Intronic
1023470166 7:40508795-40508817 ATTTGGGTTATCTTGGAAAGAGG - Intronic
1024695488 7:51852425-51852447 ATATGGGGTTCCTGGGACAAGGG + Intergenic
1028129967 7:87160006-87160028 ATTTGGTTTATCTGGAAAACAGG - Intronic
1028280081 7:88913838-88913860 AGTTGGGCTTCTTGGAAAACAGG - Intronic
1031077877 7:117230171-117230193 CCTTGAGTTTCCTGGGAACCTGG + Intergenic
1035015228 7:155759839-155759861 CTTTGGATTGCCAGGGAAACCGG + Intronic
1037564369 8:20105128-20105150 ATCTGGGTTTCATGGGATGCAGG + Intergenic
1037835518 8:22212877-22212899 ATTTGGGTCACCTGGGAAGTGGG - Intergenic
1038003561 8:23410886-23410908 CGTTGTGTTTCCTGGGAAAAAGG - Intronic
1038755867 8:30340211-30340233 ATCTTGGTATCCTGGGAGACTGG + Intergenic
1040270901 8:45941709-45941731 TTGTGGATTTCCTTGGAAACGGG + Intergenic
1041234014 8:55780609-55780631 TTGTGGGTTTACTGGAAAACAGG - Intronic
1042203540 8:66305070-66305092 ATTTGTGTTTCTTGGGCAAATGG + Intergenic
1044995603 8:97835419-97835441 GTTTGGTTTAGCTGGGAAACTGG - Intronic
1046154514 8:110269712-110269734 ATTTGTGTTTCCTAGGGGACTGG - Intergenic
1046762932 8:118040326-118040348 ATTTTGGTTACCTGGGAGATGGG + Intronic
1047429761 8:124781028-124781050 TTAAGTGTTTCCTGGGAAACAGG + Intergenic
1047846174 8:128807878-128807900 AATTGGATTTCCTGGGAAGTAGG - Intergenic
1047945805 8:129878143-129878165 AATTGGGTTTCAGGGGAAATTGG - Intronic
1049283537 8:141762573-141762595 ATGTCAGTCTCCTGGGAAACAGG + Intergenic
1049340531 8:142109920-142109942 CTGTGGTTTCCCTGGGAAACCGG + Intergenic
1050089441 9:2002032-2002054 ATTGGGATTTCAGGGGAAACTGG + Intergenic
1051509718 9:17864009-17864031 ATTTAATTTTCCTGGAAAACTGG + Intergenic
1051676003 9:19558838-19558860 AATTAGGTTTCCTTGGAAACTGG + Intronic
1052591665 9:30504020-30504042 TTATGAGTTTCCTGGGAAAGGGG - Intergenic
1054861525 9:69958571-69958593 ATTTGGCTTTTCTGGGCAGCAGG + Intergenic
1055071372 9:72169807-72169829 ATTTGGTTTTCCAGGGGAACTGG + Intronic
1057612195 9:96555100-96555122 TTTGGGGTTGCCTGGGAAGCTGG - Intronic
1057815595 9:98291708-98291730 AGCAGGGTTTCCAGGGAAACTGG - Intronic
1057914481 9:99045272-99045294 TTGAGGGTTTCCTGGGAAATTGG - Intronic
1058016144 9:100034405-100034427 ATTTGAGTTTTCTAGGAAAGTGG - Intronic
1059127605 9:111707794-111707816 TTTTGCTTTTCCTGTGAAACTGG + Intronic
1060542899 9:124442950-124442972 ATTTTGCTTTCCTGTGAAAAGGG - Intergenic
1061826662 9:133262158-133262180 TTTTGGTTTTCCTGGAAAACAGG + Exonic
1062121897 9:134838404-134838426 CTTTGGGTTCCATGGGAGACAGG - Intronic
1062326668 9:136015652-136015674 CTTGGGGCTTCCTGGAAAACCGG + Intronic
1186095122 X:6092250-6092272 ATTTGGGTGTCCTGAGCAAAGGG + Intronic
1186333349 X:8560139-8560161 ATTTGTTTTTCTTTGGAAACAGG + Intronic
1186832037 X:13400422-13400444 TTTTGCATTTCCTGGGAAACTGG + Intergenic
1188642642 X:32525077-32525099 ATCTTGATTTCATGGGAAACAGG + Intronic
1189703332 X:43734295-43734317 ATGAGAGTTTCCTTGGAAACTGG + Intronic
1190464928 X:50717008-50717030 ATTTAGTCTTCCTGGGAAGCAGG - Intronic
1195112153 X:101659267-101659289 ATTTGGGAGTGCTGGGAAATGGG - Intronic
1195155138 X:102115600-102115622 TTGGGGCTTTCCTGGGAAACAGG - Intergenic
1198639452 X:138740885-138740907 ATAATGGTTTTCTGGGAAACAGG - Intronic
1199057153 X:143310304-143310326 ATTTGATTTTCAAGGGAAACTGG + Intergenic
1199703048 X:150399460-150399482 ATGTGAGTTTACTGGGAAATAGG + Intronic
1199799008 X:151230948-151230970 ATTGGGGTTTCCTTGGGAAAGGG + Intergenic
1199935590 X:152570320-152570342 ATTTGGGTTCTTTGGGAAACAGG + Intergenic
1200793953 Y:7323725-7323747 ATATGTGTATCCTGGGAAATGGG - Intergenic