ID: 1078945823

View in Genome Browser
Species Human (GRCh38)
Location 11:16067588-16067610
Sequence CCTCATTAGCAGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1506
Summary {0: 1, 1: 1, 2: 23, 3: 473, 4: 1008}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078945820_1078945823 -7 Left 1078945820 11:16067572-16067594 CCAGTCTCTGGTATGTCCTCATT 0: 1
1: 9
2: 235
3: 2355
4: 7344
Right 1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG 0: 1
1: 1
2: 23
3: 473
4: 1008
1078945816_1078945823 23 Left 1078945816 11:16067542-16067564 CCATTAAACCTCTTTTTCTTTAT 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
Right 1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG 0: 1
1: 1
2: 23
3: 473
4: 1008
1078945817_1078945823 15 Left 1078945817 11:16067550-16067572 CCTCTTTTTCTTTATAAATTACC 0: 1415
1: 1580
2: 1055
3: 773
4: 1268
Right 1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG 0: 1
1: 1
2: 23
3: 473
4: 1008
1078945819_1078945823 -6 Left 1078945819 11:16067571-16067593 CCCAGTCTCTGGTATGTCCTCAT 0: 1
1: 30
2: 698
3: 5814
4: 11072
Right 1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG 0: 1
1: 1
2: 23
3: 473
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078945823 Original CRISPR CCTCATTAGCAGCATGAGGA TGG Intronic
900749043 1:4382458-4382480 CTTTATTAGCAGCATGACAATGG - Intergenic
900878228 1:5361359-5361381 CTTCATTAGCAGCATAAGAATGG + Intergenic
901246984 1:7739486-7739508 CCTTATCAGCAGCGTGAGAATGG - Intronic
901252607 1:7792089-7792111 CTTTATTAGCAGCATGAGAATGG - Intronic
901310749 1:8267722-8267744 CTCTATTAGCAGCATGAGAATGG - Intergenic
902065045 1:13678591-13678613 CTTTATTAGCAGCATGAGAACGG - Intergenic
902182959 1:14703594-14703616 CTTTATTAGCAGCATGAGAATGG + Intronic
902238427 1:15072889-15072911 CCTCATTAGTAGGATGAGGCCGG + Intronic
902646572 1:17803643-17803665 CTTATTTAGCAGCATGAGGACGG + Intronic
902697239 1:18148442-18148464 CTTTATTAGCAGCATGAAAACGG + Intronic
902939744 1:19792156-19792178 CTTCATCAGCAGCATGAAAATGG + Intronic
903483852 1:23675070-23675092 CTTTATTAACAGCATGAGAACGG + Intergenic
903591803 1:24461954-24461976 CTTTATTAGCAACATGAGAATGG - Intronic
903919140 1:26787373-26787395 CCTCATTAGCCACCTGAGGTGGG + Intergenic
904378880 1:30097932-30097954 CTTTATTAGCAGCATGAAAATGG - Intergenic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905319379 1:37105122-37105144 CCTCAGTAGCAGCAGGTGGCAGG - Intergenic
905398376 1:37683238-37683260 CCTCTTTGGAAGCATTAGGAAGG - Intronic
905477253 1:38237826-38237848 CTTTATTAGCAGCATGAAAATGG + Intergenic
905855443 1:41308524-41308546 CTTTATTAGTAGCATGAGAATGG - Intergenic
906390117 1:45407812-45407834 CTTTATTAGCAGCATGAGAAAGG + Intronic
906463666 1:46057336-46057358 CCTTATCAGCAGCATGAAAACGG + Intronic
906780716 1:48570704-48570726 CAACATTTACAGCATGAGGAAGG - Intronic
906835762 1:49082331-49082353 CTTTATTAGCAGCATTAGAATGG - Intronic
906891452 1:49720015-49720037 CTTTATTAGCAGCATAAGAATGG + Intronic
907381839 1:54097060-54097082 CCTCATTAGTAGCCTCAGCATGG - Exonic
907713187 1:56903487-56903509 CTTTATTAGCAGCATGAGAATGG + Intronic
907840076 1:58148532-58148554 CTTTATTAGCAGCATGAGAATGG - Intronic
907875382 1:58481953-58481975 TTTCATTAGCAGCATGAGAATGG + Intronic
908048890 1:60205976-60205998 CTTTATTAGCAGCATGAAAATGG + Intergenic
908112487 1:60910984-60911006 CTTTATTAGCAGCATGAGAACGG + Intronic
908118885 1:60967053-60967075 CCTTTTTAGCAGCACGAGAATGG - Intronic
908212973 1:61920539-61920561 CTTTATTAGCAGCATGAAAACGG + Intronic
908541766 1:65129037-65129059 CTTTATTAGCAGCATGAGAACGG - Intergenic
908715956 1:67069160-67069182 CTTTATGAGCAGCATGAGAATGG + Intergenic
908800115 1:67871356-67871378 CTTTATTAGCAGCATGAGAATGG + Intergenic
908911040 1:69072431-69072453 CTTCATCAGCAGCATGAAAATGG - Intergenic
908911295 1:69074376-69074398 CTTTATTAGCAGCATGAAAATGG - Intergenic
908963356 1:69728852-69728874 CTTCATTAGCAGTGTGAGAATGG - Intronic
909144026 1:71906098-71906120 CCGTTTTAGCAGCATGAGTAGGG - Intronic
909177473 1:72379649-72379671 CTTTATTAGCAGCATCAGAATGG - Intergenic
909177749 1:72381592-72381614 CTTTATTAGCAGCATGGGAATGG - Intergenic
909181574 1:72430179-72430201 CTTTATTAGCAGCATGAGAATGG + Intergenic
909189274 1:72531862-72531884 CTTTATTAGCAGCATGAGAATGG - Intergenic
909229193 1:73063099-73063121 CCTTATTAGCAGAGTGAGAAAGG + Intergenic
909371453 1:74887212-74887234 CTTTATTAGCAGCATGAGAAGGG + Intergenic
909429530 1:75570863-75570885 CCTAATTACTAGGATGAGGAGGG - Intronic
909457938 1:75870763-75870785 CTTTCTTAGCAGCATGAGAAAGG + Intronic
909510913 1:76451185-76451207 CTTTCTTAGCAGCATGAGAATGG - Intronic
909702367 1:78541552-78541574 CTTTATTAGCAGCATGAAAAGGG - Intergenic
909751520 1:79166670-79166692 CTTTAGTAGCAGCATGAGAATGG + Intergenic
909854627 1:80513180-80513202 CTTTATTAGCAGCATGATAATGG - Intergenic
909883060 1:80904707-80904729 CTTTATTAGCAGCATGAGAATGG - Intergenic
909910843 1:81256055-81256077 CTTTATTAGCAGGATGAGAACGG - Intergenic
910378839 1:86603477-86603499 CATTATTAGCAGCATGAGAATGG - Intergenic
910643659 1:89490455-89490477 CTTAATCAGCAGCATGAGAATGG - Intergenic
910707038 1:90140707-90140729 CTTTATTAGCAGCATGAGAATGG - Intergenic
910740505 1:90510507-90510529 CTTTATTAGCAGCCTGAGAACGG + Intergenic
911031093 1:93489120-93489142 TTTCTTCAGCAGCATGAGGAAGG + Intronic
911032350 1:93503100-93503122 CTTTATTAGCAGCGTGAGAATGG - Intronic
911197704 1:95012220-95012242 CCTTATTGGCAGCATGAAAATGG + Intronic
911236470 1:95417752-95417774 CTTTATTAGCAGCATGAGAATGG - Intergenic
911286229 1:95997045-95997067 ATTTATTAGCAGCATGAGAATGG - Intergenic
911387479 1:97194813-97194835 CTTTATTAGCAGCATGAGAATGG + Intronic
911705423 1:101006216-101006238 CTTTATTAGAAGCATGAGAATGG + Intronic
911830850 1:102550062-102550084 CTTCATTAGCAGCATGAGAATGG - Intergenic
911941510 1:104053253-104053275 CTTTATTAGCAGCATGAGAATGG - Intergenic
912157918 1:106945274-106945296 CTTTATTAGCAGCATGAGAATGG - Intergenic
912660656 1:111526552-111526574 CTTTATTAGCAGCATGAAAATGG + Intronic
912688346 1:111784854-111784876 CATCTTTAGCAGCGAGAGGAAGG + Intronic
912712512 1:111960156-111960178 CTTTATTAGCAGCATGAGAACGG + Intronic
913208568 1:116564457-116564479 CTTTATTAGCAGCATGAGAATGG - Intronic
913286794 1:117233996-117234018 CTTTATTAGCAGCATGAGAACGG - Intergenic
913392307 1:118327864-118327886 CTTTATTAGCAGCATGAGAATGG + Intergenic
913481040 1:119289461-119289483 CTTTATTAGCAGCATGAGAATGG + Intergenic
914880345 1:151541546-151541568 CCTCAAGAGCAGGATGAGGCAGG - Intronic
914965505 1:152253837-152253859 CTTTATTAGCAGCATAAGAATGG + Intergenic
915244071 1:154543968-154543990 CCTCAGGAGCAGCACCAGGAAGG - Exonic
915803921 1:158824404-158824426 CTTTATTAGCAGCATGAAAACGG + Intergenic
916734923 1:167599086-167599108 CTTCATCAGCAGCATGAAAATGG - Intergenic
916828257 1:168464203-168464225 CTTTATTAGCAGCATGAGAACGG - Intergenic
916839713 1:168587099-168587121 CTTTATTAGCAGCATGAGAACGG - Intergenic
916904277 1:169264831-169264853 CTTTATTAGCAGCATGAGTACGG - Intronic
916948668 1:169757465-169757487 CTTTATTAGCAGCATGAGAAAGG - Intronic
917586329 1:176430807-176430829 CTTTATTAGCAGCATGAGAATGG - Intergenic
917720423 1:177781863-177781885 CTTTATTAGCAGCGTGAGAATGG - Intergenic
917892653 1:179454437-179454459 CTTTATTAGCAGCATGAAAATGG + Intronic
917895164 1:179480180-179480202 CTTTATCAGCAGCATGAGAATGG - Intronic
918015378 1:180628563-180628585 CTTTATTAGCAGCATGAAAACGG - Intergenic
918247402 1:182671984-182672006 CCTCATTGGCAGGATGCAGAAGG + Intronic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
918717991 1:187817065-187817087 CTTTATTAGCAGCATGAGAATGG - Intergenic
918734345 1:188038995-188039017 CTTTATTAGCAGCATGAAAATGG + Intergenic
918803868 1:189013506-189013528 CTTAATTAGCAGCATGAAAATGG + Intergenic
919011848 1:191974868-191974890 CTTTATTAGCAGCACGAGAATGG - Intergenic
919162224 1:193845189-193845211 CTTTATTAGCAGCATGAGAATGG + Intergenic
919173654 1:193990732-193990754 CTTTATTAGCAGCATGAAAATGG + Intergenic
919502559 1:198355731-198355753 TCTTTTTAGCAGCATGAGAACGG + Intergenic
920163451 1:204017737-204017759 CTTTATTAGCAGCGTGAGAAGGG + Intergenic
920594371 1:207254532-207254554 CTTTATTAACAGCATGAGAATGG - Intergenic
920897311 1:210066769-210066791 CTTTATTAGCAGCGTGAGAACGG + Intronic
921399374 1:214703664-214703686 CTTTATTAGCAGCATGAGAATGG + Intergenic
921440874 1:215184463-215184485 CTTTATTAGCAGCGTGAGAATGG - Intronic
921628489 1:217404505-217404527 CCTTATCAGCAGCATGAAAACGG - Intergenic
921695446 1:218203910-218203932 CTTTATTAGCAGCATGAGTACGG + Intergenic
921761888 1:218924286-218924308 CTTTATTAGCAGCATGAGAATGG + Intergenic
921799119 1:219381373-219381395 CTTTATTAGCAACATGAGAATGG + Intergenic
921886092 1:220307920-220307942 CCTCATTCCAAGCAGGAGGAAGG - Intergenic
921970331 1:221141438-221141460 CTTTATTAGCAGCATGAGAATGG + Intergenic
921989854 1:221353516-221353538 CTTTATTAGCAGCATGTGAACGG - Intergenic
922671037 1:227508923-227508945 CCTCATTTTCTTCATGAGGAGGG + Intergenic
923179278 1:231500254-231500276 CTTTATTAGCAGCATGAGAATGG - Intergenic
923249103 1:232162960-232162982 CTTTATTAGCAACATGAGAATGG - Intergenic
923387343 1:233478359-233478381 CTTTATTAGCAGCATAAGGATGG - Intergenic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
923762318 1:236858122-236858144 CTTTATCAGCAGCATGAGAATGG - Intronic
923808822 1:237289351-237289373 CTTTATTAGCAGCATGAGAAAGG - Intronic
923876691 1:238057696-238057718 CTTTATCAGCAGCATGAGAATGG - Intergenic
923911731 1:238454102-238454124 CTTTATTAGCAGCATGAGAATGG + Intergenic
924020502 1:239776677-239776699 CTTTATTAGCAGCATGAGAATGG - Intronic
924036372 1:239942805-239942827 CTTTATTAGCAGCATGAAAAAGG - Intergenic
1062861112 10:810493-810515 GCTCAACAGCTGCATGAGGAGGG - Exonic
1063048699 10:2420915-2420937 CTTTATTAGCAGCATGAAAACGG + Intergenic
1063222152 10:3979202-3979224 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063712253 10:8490945-8490967 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063715449 10:8522251-8522273 CTTTATTAGCAGCATGAGAACGG - Intergenic
1063722667 10:8599845-8599867 CTTTATTACCAGCATGAGAATGG - Intergenic
1063841526 10:10077065-10077087 CTTTATCAGCAGCATGAGAACGG + Intergenic
1064011335 10:11738939-11738961 CTTCATTAGCAGCATGAAAATGG - Intergenic
1064129887 10:12700185-12700207 CTTTATTAGCAGCATGAGAATGG - Intronic
1064232891 10:13545018-13545040 CTTTATTAGCAGCATGAGAACGG + Intergenic
1064501353 10:15976926-15976948 CTTTATTAGCAGCATGAGAATGG + Intergenic
1064783352 10:18866936-18866958 TTTTATTAGCAGCATGAGAATGG + Intergenic
1064941607 10:20741585-20741607 TTTCATTAGCAGCATGAGAATGG + Intergenic
1065056106 10:21844183-21844205 CTTTATTAGCAGCATGAAAATGG + Intronic
1065398402 10:25267171-25267193 CTTTATTAGCAGCATGAGAATGG - Intronic
1065439311 10:25733615-25733637 CTTTATTAGCAACATGAGAATGG + Intergenic
1065456226 10:25909414-25909436 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1066044016 10:31580667-31580689 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1066194938 10:33090086-33090108 CTTCATTAGCAGCATAAGAACGG + Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067812425 10:49440156-49440178 CTTTATTAGCAGCATGAAAATGG - Intergenic
1067900525 10:50236177-50236199 CTTTATTAGCAGCATGAGAATGG - Intronic
1068172717 10:53416769-53416791 CTTTATTAGCAGCATGAAAATGG + Intergenic
1068422806 10:56819061-56819083 CTTCATTAGCAGTGTGAGAATGG - Intergenic
1068747640 10:60553068-60553090 CTTTATCAGCAGCATGAGAATGG + Intronic
1068777256 10:60881278-60881300 CTTCATTAGCAGCATGAAAATGG + Intronic
1068778380 10:60892130-60892152 CTTTATTAGCAGCATGAGAATGG + Intronic
1069339761 10:67397023-67397045 CTTTATTACCAGCATGAGAATGG + Intronic
1070005515 10:72420476-72420498 CTTTATTAGCAGCATGAGAATGG + Intronic
1070734695 10:78855489-78855511 TCTCATTAGGAGTGTGAGGAAGG + Intergenic
1071169622 10:82848990-82849012 CTTTATTAGCAGTATGAGAATGG + Intronic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1071990427 10:91096232-91096254 CTTTATTAGCAGTATGAGAATGG - Intergenic
1072322011 10:94259752-94259774 CTTCATCAGCAGCATGAAAATGG - Intronic
1072634354 10:97167991-97168013 CTTCATTAGCAGTGTGAGAACGG + Intronic
1072922415 10:99587600-99587622 GCTCTTTTGGAGCATGAGGAGGG + Intergenic
1073142577 10:101258590-101258612 CATCACTGGCAGCAGGAGGATGG + Intergenic
1073669364 10:105570527-105570549 CTTTATTAGCAGCATGAGAATGG - Intergenic
1073811103 10:107152782-107152804 CTTTATTAGCAGCATGAGAATGG + Intronic
1073977869 10:109120538-109120560 CTTTATTAGCAGCATGAGAATGG + Intergenic
1074084219 10:110195342-110195364 CCACTTTAGGAGGATGAGGAAGG + Intergenic
1074222831 10:111455131-111455153 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074451607 10:113564003-113564025 CTTTATTAGCAGCATGAGAATGG - Intronic
1074491391 10:113942388-113942410 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074500661 10:114020978-114021000 CTTTATCAGCAGCATGAGAACGG + Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1074794425 10:116927327-116927349 CTTTATTAGCAGCATGAGAATGG - Intronic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074911875 10:117918204-117918226 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1074957235 10:118404080-118404102 CCTCTTTAGCAGCATTAAGATGG + Intergenic
1075178840 10:120191514-120191536 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075536758 10:123278027-123278049 CTTTATCAGCAGCATGAGAATGG - Intergenic
1075646626 10:124101100-124101122 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1075681270 10:124334546-124334568 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075825993 10:125357407-125357429 CTTCATCAGCAGCATGAAAATGG - Intergenic
1075920402 10:126207117-126207139 CTTTATTAGCAGCATGAAAACGG + Intronic
1075937698 10:126357517-126357539 CTTTATTAGCAGCATGAGAATGG - Intronic
1075941890 10:126396825-126396847 CTTTATTAGCAGCATGAGCACGG + Intergenic
1075964917 10:126603146-126603168 CTTTATTAGCAGCGTGAGAACGG - Intronic
1075985433 10:126780957-126780979 CTTTATTAGCAGCATGAGAATGG + Intergenic
1076207773 10:128616765-128616787 CTTTATTAGAAGCATGAGAAAGG + Intergenic
1076243240 10:128926254-128926276 CTTTATTAGTAGCATGAGAAGGG + Intergenic
1076674659 10:132141778-132141800 TCTCTCTAGCAGCATGAGGGAGG - Intronic
1076907367 10:133369761-133369783 GCTCTTTAGCACCATGAGGCAGG + Intronic
1077724481 11:4660844-4660866 CCCCATCAGCATCCTGAGGATGG + Intergenic
1077797239 11:5505495-5505517 CTTCATTAGCAGCGTGAAAACGG - Intronic
1077929416 11:6714922-6714944 CCCCATTGACAGCCTGAGGACGG + Intergenic
1078104191 11:8348230-8348252 CTTTATTAGCAGCATGAGAATGG - Intergenic
1078106249 11:8359838-8359860 CCCCCTTAGCAGCAAGAGAAAGG + Intergenic
1078517798 11:12039612-12039634 CTTTATCAGCAGCATGAGAATGG - Intergenic
1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG + Intronic
1079122881 11:17697644-17697666 CCTCATCAGAAAGATGAGGATGG - Intergenic
1079147724 11:17868640-17868662 CTTTATTAGCAGCATGAAAATGG - Intronic
1079409598 11:20174901-20174923 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079475625 11:20826187-20826209 CTTTATTAGCAGCATGAGAATGG + Intronic
1079557332 11:21775557-21775579 CCTCAATAGCTGCATGATGCTGG + Intergenic
1079568682 11:21915745-21915767 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1079671055 11:23171841-23171863 CTTTATTAGCAGCCTGAGAATGG - Intergenic
1079838354 11:25364265-25364287 CCTTATCAGCAGCATGAAAATGG - Intergenic
1079958266 11:26890385-26890407 TCTTATTAGCAACATGAGGATGG + Intergenic
1080110557 11:28562219-28562241 CTTCATCAGCAGCATGACAACGG + Intergenic
1080115220 11:28614710-28614732 CTTTATTAGCAGTATGAGAATGG - Intergenic
1080158935 11:29148105-29148127 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1080184035 11:29457794-29457816 CTTTATTAGCAGCATAAGAATGG + Intergenic
1080194701 11:29595470-29595492 CTTTATTAGCAGCATGAGAATGG + Intergenic
1080290387 11:30664528-30664550 GTTTATTAGCAGCATGAGAATGG - Intergenic
1080423329 11:32132797-32132819 CTTTATTAGCAGCATAAGAATGG + Intergenic
1080721054 11:34849009-34849031 CCTTATTAGCAGTGTGAGAATGG + Intergenic
1080949437 11:37013373-37013395 CTTTATTAGCAGTATGAGAATGG + Intergenic
1081016396 11:37887110-37887132 CTTCATTAGCAGCATGAGAATGG - Intergenic
1081108407 11:39101088-39101110 CTTCATCAGCAGCATGAAAATGG - Intergenic
1081188752 11:40078078-40078100 CTTCATTGGCAGCATGAGAACGG - Intergenic
1081238789 11:40678816-40678838 CTTTATTAGCAGCATGAGAACGG + Intronic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081414170 11:42793389-42793411 CTTTATTAGCAGCATGAGAATGG + Intergenic
1081444518 11:43117691-43117713 CTTCATTAGCAGCATGAGAATGG - Intergenic
1081455659 11:43220019-43220041 CTTTATTAGCAGCATGAAAATGG - Intergenic
1081460983 11:43272819-43272841 CTTTATTAGCAGCTTGAGAAGGG + Intergenic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1082141146 11:48610990-48611012 CCTCCTTACCTACATGAGGACGG - Intergenic
1082568304 11:54707819-54707841 CCTCCTTACCTACATGAGGACGG - Exonic
1082618280 11:55389462-55389484 CCTCCTTACCTACATGAGGATGG - Intergenic
1082745303 11:56954739-56954761 CTTTATTAGCAGCATGAAAATGG - Intergenic
1082941921 11:58714853-58714875 CTTTATTAGTAGCATGAGAACGG + Intronic
1083492140 11:63020990-63021012 GCTCCTTAGCAGCAGGCGGAGGG + Intergenic
1083497680 11:63072569-63072591 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1084230394 11:67748213-67748235 CTTTATTAGTAGCATGAGAATGG + Intergenic
1084298564 11:68229658-68229680 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1084436189 11:69142068-69142090 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1084741387 11:71141656-71141678 CGTTATTACCAGCATGAGAATGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085866660 11:80302915-80302937 CTTTATCAGCAGCATGAGAATGG + Intergenic
1085873907 11:80383660-80383682 CTTTATTAGCAGCATGAGAATGG + Intergenic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086333908 11:85781070-85781092 CTTCATTAGCAGCATTGGAATGG - Intronic
1086334183 11:85783083-85783105 CTTTATTAGCAGCATAAGAATGG - Intronic
1086816174 11:91373843-91373865 TCTTCTTAGCAGCATGAGAATGG + Intergenic
1086942519 11:92813175-92813197 CTTTATTAGCAGCATGAGAACGG + Intronic
1086992107 11:93314632-93314654 CTTTATTAGCAGCATGATAATGG - Intergenic
1087472025 11:98587828-98587850 CTTTATTAGCAGCATGAGAATGG - Intergenic
1087675496 11:101157259-101157281 CTTTATTAGCAGCATGAGAATGG + Intergenic
1087675777 11:101159307-101159329 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1087690787 11:101318398-101318420 CCTTATTAGCAGCATGAAAATGG - Intergenic
1087960938 11:104348071-104348093 CTTTATTAGCAGTATGAGAACGG + Intergenic
1088000688 11:104876598-104876620 CTTTATTAGCAACATGAGAATGG - Intergenic
1088162958 11:106895704-106895726 CTTTCTTAGCAGCATGAGAATGG + Intronic
1088236670 11:107732378-107732400 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1088389005 11:109292455-109292477 CTTTATTAGCAGCATGAAAATGG + Intergenic
1088544831 11:110948707-110948729 CTTTATTAGCAGCATGAAAATGG - Intergenic
1088545765 11:110957213-110957235 CCTCATTAGCAGCTTGTGCTAGG - Intergenic
1090321401 11:125846834-125846856 CTTTATTAGCAGCACGAGAATGG - Intergenic
1090777433 11:129977706-129977728 CCACTTTGGGAGCATGAGGAGGG + Intronic
1091060939 11:132461649-132461671 CTTTATTAGCAGTATGAGAATGG - Intronic
1091077048 11:132628988-132629010 CTTTATTAGCAGGATGAGAATGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1093277816 12:17151657-17151679 CTTTATTAGCAGCATGAAAATGG - Intergenic
1093784212 12:23174086-23174108 CTTTATTAGCAGCATCAGAATGG - Intergenic
1094181665 12:27598165-27598187 CTTTATTAGCAGCATGAGAATGG - Intronic
1094281470 12:28744442-28744464 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1094299116 12:28940971-28940993 CTTTATTAGCAGCATGAGAATGG + Intergenic
1094781467 12:33796436-33796458 CTTTATTAGCAGCAAGAGAATGG + Intergenic
1094801031 12:34036275-34036297 CTTTATTGGCAGCATGAGAATGG - Intergenic
1095109757 12:38280030-38280052 CCTTTATAGCAGCATGAGAATGG + Intergenic
1095114170 12:38332287-38332309 CTTTATTGGCAGCATGAGAATGG - Intergenic
1095362487 12:41359787-41359809 CTTTATTAGCAGCGTGAGAACGG + Intronic
1095394817 12:41750064-41750086 CTTTATTAGCAGCATGAAAACGG - Intergenic
1095490898 12:42732785-42732807 TATCTTTAGCAGCATGAGAATGG + Intergenic
1095522490 12:43084406-43084428 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1095540415 12:43303440-43303462 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1095807005 12:46330734-46330756 TCTTTTTAGCAGCATGAGAATGG - Intergenic
1095915149 12:47470708-47470730 CTTTATTAGCAGCATGAGAATGG + Intergenic
1096212888 12:49779934-49779956 ATTTATTAGCAGCATGAGAATGG + Intergenic
1096522479 12:52192040-52192062 GCTCATTAGCTGCAGGAGGGCGG + Intergenic
1097242536 12:57585496-57585518 CCACCTTAGCACCATGTGGAAGG - Exonic
1097402655 12:59148317-59148339 CTTTATTGGCAGCATGAGAACGG + Intergenic
1097464099 12:59901191-59901213 CTTGATTAGCAGCATGAAAATGG + Intergenic
1097526374 12:60740978-60741000 CTTTATTAGCAGCATGATAATGG - Intergenic
1097617474 12:61900414-61900436 CTTTATTAGCAGCATGATAATGG - Intronic
1097618225 12:61908530-61908552 CTTTATTAGCAGCATGAGAACGG + Intronic
1098335245 12:69397681-69397703 CTTTATTAGCAGCATGAAAATGG + Intergenic
1098578257 12:72069527-72069549 CTTTATTAGCAGCATGAGAATGG - Intronic
1098578571 12:72071916-72071938 CTTTATTAGCAGCATGAGAATGG - Intronic
1098592421 12:72229151-72229173 CTTTTTTAGCAGCATGAGAATGG - Intronic
1099048327 12:77751686-77751708 CTTTATTAGCAGCATGAGAATGG + Intergenic
1099218125 12:79878529-79878551 CTTTATTAGCAGCATAAGAACGG - Intronic
1099295669 12:80825181-80825203 CGTCATTGCCAGCATGAAGAAGG + Intronic
1099560287 12:84164783-84164805 CTTTATTAGCAGCATGAAAATGG - Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1099767534 12:87007030-87007052 CCTTATTAGCAGTGTGAGAATGG + Intergenic
1099812644 12:87604711-87604733 CCTTATTAGCAGCATGAAAATGG - Intergenic
1099826278 12:87780988-87781010 CTTTATTAGCGGCATGAGAACGG - Intergenic
1099891502 12:88593792-88593814 CTTTATTAGCAGCATAAGAAAGG + Intergenic
1099908467 12:88800411-88800433 CTTTATTAGCAGCATGAGAATGG - Intergenic
1100107612 12:91196035-91196057 CTTTATTAGCACCTTGAGGATGG - Intergenic
1100147605 12:91697428-91697450 CTTCATTAACAGCATAAGAACGG - Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100658087 12:96668318-96668340 CTTTATTAGCAGCATGAGAATGG - Intronic
1101127315 12:101650318-101650340 CTTTATTAGCAGCATGAGAACGG - Intronic
1101190442 12:102326886-102326908 CCTTATTAGCAGCATGAGAATGG + Intergenic
1101194475 12:102368801-102368823 CTTTATTAACAGCATGAGAATGG - Intergenic
1101314786 12:103619131-103619153 CTTTATTAGCAGCATGAGAATGG + Intronic
1101340407 12:103837948-103837970 CTTTATTAGCAGCATGAAAATGG - Intronic
1101449905 12:104766624-104766646 CTTTATTAGCAGCATGAGAATGG + Intergenic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1102485528 12:113252774-113252796 CCACATGAGCAGATTGAGGACGG + Intronic
1102731855 12:115118571-115118593 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1102745888 12:115248742-115248764 CTTTATTAGCAGCATGAAAATGG - Intergenic
1103047698 12:117751331-117751353 CTTCATTAGCAGCGTGAGAACGG + Intronic
1103264751 12:119619282-119619304 CTTTATTAGCAGCATAAGAATGG + Intronic
1104128508 12:125870284-125870306 CTTTATTAGCAGCTTGAGAACGG + Intergenic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1104262679 12:127198905-127198927 CTTTATTAGCAGTATGAGAACGG - Intergenic
1104300549 12:127560770-127560792 CCTTTATAGCAGCATGAGAATGG + Intergenic
1104321097 12:127751716-127751738 CTTCATTAGCAGCATGAGACTGG - Intergenic
1104510820 12:129376203-129376225 CTTTATTAGCAGCATGAGAATGG - Intronic
1104528832 12:129549648-129549670 CTTTATCAGCAGCATGAGAATGG + Intronic
1104535791 12:129616801-129616823 CTTCATTAGCAGCGTGAGAATGG + Intronic
1104549518 12:129743578-129743600 CTTTATTAGCAGCATGAGAATGG + Intronic
1104645780 12:130496422-130496444 CTTTATTAGCAGCATGAAAAAGG + Intronic
1105724755 13:23151729-23151751 ATTTATTAGCAGCATGAGAATGG - Intergenic
1106154698 13:27143292-27143314 ACTCATTTGCAGCATGGGTAGGG + Intronic
1106499075 13:30309691-30309713 CTTTATTAGCAGCATGAAAACGG + Intergenic
1107066591 13:36219998-36220020 CTTTATTAGCAGCATGAGAATGG + Intronic
1107312758 13:39097476-39097498 CTTTATTAGCAGCATGAGAATGG - Intergenic
1107342442 13:39422768-39422790 CTTTATTAGCAGCATGAGAATGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107693815 13:42980339-42980361 CTTTATTAGCAGCATGAGAATGG - Intronic
1107766970 13:43745992-43746014 CTTTATTAGCAGCATGAGAATGG + Intronic
1108266471 13:48713829-48713851 CTTTATTAGCAGCATGAAAATGG - Intergenic
1108745514 13:53389417-53389439 CTTTATCAGCAGCATGAGAATGG - Intergenic
1108796022 13:54032387-54032409 CTTTATTAGCAGCATAAGAAGGG - Intergenic
1108829065 13:54453925-54453947 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1108858190 13:54821364-54821386 CTTTATTAGCAGCATGAAAATGG + Intergenic
1108908796 13:55515971-55515993 CTTTATTAGCAGCATGCGAATGG + Intergenic
1109132184 13:58601493-58601515 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1109211703 13:59542636-59542658 GCTCATTAGCCTAATGAGGATGG + Intergenic
1109448131 13:62471953-62471975 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109718511 13:66247200-66247222 CTTTATTAGCAGGATGAGAATGG + Intergenic
1109730101 13:66401525-66401547 CTTTATTAGCAGCATGAGAATGG + Intronic
1109740839 13:66552785-66552807 CTTTATTAGCAGCATGAGAATGG - Intronic
1109863108 13:68225844-68225866 CTTTATTAGCAGCATGAAAATGG - Intergenic
1110007905 13:70294914-70294936 CTTTATTAGCAGCATGAGAACGG + Intergenic
1110169157 13:72479758-72479780 TCTTCATAGCAGCATGAGGATGG + Intergenic
1110170301 13:72492305-72492327 CTTTATTAGCAGCATGAGATTGG + Intergenic
1110208815 13:72948628-72948650 CTTTATTAGCAGCATGAGAATGG - Intronic
1110438505 13:75502252-75502274 CCTTATTAGCAGCACGAGAATGG - Intergenic
1110456711 13:75697261-75697283 GTTTATTAGCAGCATGAGAATGG - Intronic
1110496619 13:76175052-76175074 CTTTATTAGCAGCCTGAGAATGG - Intergenic
1110881156 13:80574337-80574359 GTTTATTAGCAGCATGAGAATGG - Intergenic
1110929328 13:81195298-81195320 CTTTATTGGCAGCATGAGAATGG - Intergenic
1111029224 13:82574299-82574321 CCTTATCAGCAGCATGAAAATGG - Intergenic
1111074398 13:83214690-83214712 CTTTATCAGCAGCATGAGAATGG - Intergenic
1111103128 13:83612641-83612663 CTTCATTAGCAGCATGAAAACGG - Intergenic
1111225432 13:85265392-85265414 CCTGATTAGCAAGATGAGGCAGG + Intergenic
1111225443 13:85265619-85265641 CCTGATTAGCAAGATGAGGCAGG - Intergenic
1111254467 13:85647850-85647872 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1111499877 13:89104580-89104602 CTTTATTAGCAGCATGAGAATGG + Intergenic
1111505572 13:89184588-89184610 CTCTATTAGCAGCATGAGAAAGG - Intergenic
1111539923 13:89656452-89656474 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1111601736 13:90482719-90482741 CTTTATTAGCAGCATGAGAATGG - Intergenic
1111799186 13:92961080-92961102 CTTTATTAGGAGCATGAGAATGG - Intergenic
1111799503 13:92964530-92964552 CTTTATTAGCAGCATGAAAACGG + Intergenic
1111841683 13:93457172-93457194 CTTCATTAGTAGCATGAGAATGG + Intronic
1111999188 13:95194071-95194093 CTTCCTTGGAAGCATGAGGAGGG + Intronic
1112058962 13:95717863-95717885 CTTCATCAGCAGCATGAAAACGG + Intronic
1112079161 13:95949130-95949152 CTTTATTAGCAGCATGAGAACGG + Intronic
1112142933 13:96665994-96666016 CTTTATTAGCACCATGAGAATGG - Intronic
1112288380 13:98123948-98123970 CTTCATTAGCAGCGTAAGAACGG + Intergenic
1112301859 13:98238440-98238462 CTTTATTAGCACCATGAGAACGG - Intronic
1112359764 13:98706780-98706802 CTTTATCAGCAGCATGAGAATGG + Intronic
1112391921 13:98992776-98992798 CTTTATTAGCAGCATGAGAATGG + Intronic
1112568343 13:100570235-100570257 CTTTATTAGCAGTATGAGAATGG - Intronic
1112670995 13:101638462-101638484 CCTTATCAGCAGCATGAAAACGG - Intronic
1112868958 13:103944634-103944656 CTTCATCAGCAGCATGAAAATGG + Intergenic
1112973311 13:105287188-105287210 CTTTATTAGTAGCATGAGAATGG - Intergenic
1113133257 13:107061357-107061379 CTTTATTAGCAGCATAAGAATGG - Intergenic
1113329679 13:109316258-109316280 CTTTATTAGCAGCATGAGAATGG - Intergenic
1113341885 13:109433624-109433646 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113386187 13:109850570-109850592 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113395717 13:109945649-109945671 TTTTATTAGCAGCATGAGAATGG + Intergenic
1113470897 13:110545135-110545157 CTTTATTAGCAGCATGAACACGG + Intronic
1113497644 13:110744537-110744559 CTTTATTAGCAGCATGAAAATGG - Intergenic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114921866 14:27342592-27342614 TCTTTTTAGCAGCATGAGAATGG + Intergenic
1114922115 14:27344468-27344490 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1114941832 14:27622818-27622840 CTTTATTAGGAGCATGAGAATGG - Intergenic
1114984114 14:28205702-28205724 TCTCCATAGCAGCATGAGAATGG - Intergenic
1115010487 14:28539492-28539514 CTTTATTAGCAGCATAAGAATGG + Intergenic
1115010756 14:28541417-28541439 CTTTATTAGCAGTATGAGAATGG + Intergenic
1115055746 14:29124399-29124421 CTTTATTAACAGCATGAGAAGGG - Intergenic
1115076807 14:29402927-29402949 CTTTATTAGCAGCATGAAAATGG - Intergenic
1115311398 14:31982096-31982118 TCTTCATAGCAGCATGAGGACGG + Intergenic
1115430943 14:33317795-33317817 CTTTATTAGCAGCATGAGAATGG + Intronic
1115456287 14:33607711-33607733 CTTTATTAGCAGCATGAGAACGG - Intronic
1115697832 14:35919809-35919831 CTTTATTAGCAGCGTGAGAATGG - Intronic
1116100303 14:40425290-40425312 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1116103807 14:40474772-40474794 CTTTATTAGCAGCATGAAAATGG - Intergenic
1116108223 14:40539770-40539792 CTTCATCAGTAGCATGAGAACGG - Intergenic
1116286774 14:42984687-42984709 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116287005 14:42986678-42986700 CTTTACTAGCAGCATGAGAATGG - Intergenic
1116388087 14:44357370-44357392 CTTTATTAGCAACATGAGAATGG + Intergenic
1116404398 14:44550704-44550726 CCTTATCAGCAGCATGAAAATGG - Intergenic
1116522768 14:45870286-45870308 CTTCATCAGCAGCATGAAAATGG - Intergenic
1116542147 14:46112021-46112043 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116720977 14:48495183-48495205 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116738052 14:48719589-48719611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116748638 14:48852985-48853007 CTTTATTAGCAGCATGAGAATGG - Intergenic
1117205567 14:53439571-53439593 CTTCATCAGCAGCATGAAAATGG - Intergenic
1117639134 14:57778287-57778309 CTTTATCAGCAGCATGAGAATGG + Intronic
1117968984 14:61233869-61233891 CTTTTTTAGCAGCATGAGAATGG + Intronic
1118151319 14:63194070-63194092 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118228743 14:63928008-63928030 CTTTATCAGCAGCATGAGAATGG + Intronic
1118302325 14:64626592-64626614 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118481010 14:66165894-66165916 CTTTATTAGCAGCATGAGAACGG - Intergenic
1118538169 14:66791829-66791851 CTTTATTAGGAGCATGAGAATGG - Intronic
1118775846 14:68973579-68973601 CTTTATTAGAAGCATGAGAATGG + Intronic
1119132924 14:72191409-72191431 CTTTATTAGCAGCATGAGAAAGG - Intronic
1119142856 14:72283682-72283704 CTTTATCAGCAGCATGAGAATGG + Intronic
1119150689 14:72356900-72356922 CTTTATTAGCAGCATGAGAATGG + Intronic
1119749415 14:77066930-77066952 CCTCATTAGCAGGAAGTGGGAGG + Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1119937330 14:78603923-78603945 CTTTATTAGCAGCATAAGAACGG - Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120285336 14:82493369-82493391 CTTTATTAGCAGCATGAGAATGG + Intergenic
1120323095 14:82991002-82991024 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1120810213 14:88795246-88795268 CTTTATTAGCAGCATGAGAACGG - Intergenic
1120875264 14:89369504-89369526 CCTTGTCAGCAGCATGAGAATGG - Intronic
1120887825 14:89465531-89465553 CTTTATTAGCAGCATGAGAACGG + Intronic
1121166403 14:91806234-91806256 CTTCATCAGCAGCATGAAAATGG + Intronic
1121300939 14:92870455-92870477 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301137 14:92872236-92872258 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301273 14:92873386-92873408 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301407 14:92874539-92874561 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121515580 14:94547808-94547830 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1121715489 14:96071032-96071054 CCTTATTAGCATCATGATAATGG - Intronic
1121818709 14:96948224-96948246 TCTTTTTAGCAGCATGAGAATGG + Intergenic
1121980925 14:98452903-98452925 CTTTATTAGCAGCATAAGAATGG - Intergenic
1122008032 14:98721937-98721959 CTTTATTAGCAGCATGAGAATGG + Intergenic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1123398866 15:19964408-19964430 CTTTATTAGCAGCATGATAATGG + Intergenic
1124046071 15:26150871-26150893 CCTTATCAGCAGCATGAAAATGG + Intergenic
1124225131 15:27887227-27887249 CTTTATTAGCAGCATGAAAATGG + Intronic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1124946328 15:34270459-34270481 TCTTCATAGCAGCATGAGGAAGG - Intronic
1125100143 15:35902863-35902885 CTTTATTAGCAGCATGAGAATGG + Intergenic
1125207376 15:37169435-37169457 CCTTATTAGCAGCATGAAAATGG - Intergenic
1126255973 15:46626432-46626454 CATTATTAGTAGCATGAGAATGG + Intergenic
1126496831 15:49300871-49300893 CCTTATTGGCAGCAAGAGAACGG + Intronic
1126561728 15:50051366-50051388 CTTTATTAGCAGCATGAAAACGG + Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1126909075 15:53399379-53399401 CTTTATTAGCAGCATGAGAATGG - Intergenic
1126911166 15:53418733-53418755 TCTTATTAGCATCATGAGAATGG - Intergenic
1127006029 15:54571150-54571172 CTTTATTAGCAGCATGAGAATGG - Intronic
1127009675 15:54609735-54609757 CTTTATTAGCAGCATGAGACTGG - Intronic
1127053133 15:55105694-55105716 CTTTATTAGCAGCATGAGAACGG - Intergenic
1127092548 15:55481165-55481187 CTTCATTAGCAGTGTGAGAATGG + Intronic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127525654 15:59790238-59790260 CTTTATTAGCAGCATGAGAATGG + Intergenic
1127746919 15:61987289-61987311 CTTTATTAGCAGCATGAGAATGG - Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1128535688 15:68488554-68488576 CTTTATCAGCAGCATGAGAACGG - Intergenic
1128619415 15:69136318-69136340 CTTTATTAGCAGCATGAAAATGG - Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1130149428 15:81299946-81299968 CCTCTTGGGAAGCATGAGGAAGG + Exonic
1130174480 15:81554094-81554116 CCCCATTAGCAACATGCAGAAGG - Intergenic
1130711458 15:86285656-86285678 CTTTATTAGCAGCATGAGAATGG + Intronic
1131381865 15:91970841-91970863 GGGCATTAGTAGCATGAGGACGG - Intronic
1131394652 15:92076896-92076918 CTTTATTAGCAGCATGAGAATGG - Intronic
1131421074 15:92305843-92305865 CCTCATTTTCCGGATGAGGAAGG - Intergenic
1131462723 15:92630033-92630055 CTTTATTAGCAGCATGAAAATGG + Intronic
1131558451 15:93419041-93419063 CCTTCTTAGCAGCGTGAGAAGGG + Intergenic
1131874381 15:96789272-96789294 TCTTATTAGCAGTATGAGAATGG - Intergenic
1131905030 15:97133756-97133778 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1131984053 15:98023499-98023521 CTTAATTAGCAGCATGAGAATGG + Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132388060 15:101415948-101415970 CTTCATCAGCAGCATGAAAATGG + Intronic
1132996262 16:2824985-2825007 CTTTATTAGCAGCGTGAGAATGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133698568 16:8288050-8288072 CTTTATTAACAGCATGAGAATGG - Intergenic
1133966652 16:10536641-10536663 CTTTATTAGCAGCTTGAGAATGG + Intronic
1134277911 16:12792901-12792923 CTTTATTAGCAGCATGAGAACGG + Intronic
1134476237 16:14576108-14576130 CTTTATTAGCAGCATGAAAATGG + Intronic
1134815177 16:17199829-17199851 CTTTATTAGCAGCATGAAAATGG + Intronic
1135209048 16:20508405-20508427 CTTTATTAGCAGCATGAAAATGG - Intergenic
1135276387 16:21116589-21116611 CTTCATTAGCAGCGTGAGAACGG + Intronic
1135609476 16:23853840-23853862 CTTTATTAGCAGCATGAGAATGG - Intronic
1135680153 16:24449637-24449659 CTTTATTAGCAGCATGAGAATGG - Intergenic
1135810400 16:25581540-25581562 CTTTATTAGCAGCATGAGACTGG + Intergenic
1135828738 16:25754497-25754519 CTTTATTAACAGCATGAGAATGG - Intronic
1135875084 16:26191258-26191280 CTTTATTAGCAGCATGAGAATGG + Intergenic
1136085550 16:27882337-27882359 CTTTACTAGCAGCATGAGAATGG + Intronic
1136508688 16:30722726-30722748 CCTGGTTAGCAGCAAGCGGAAGG - Exonic
1137340369 16:47596301-47596323 CTTTATTAGTAGCATGAGAATGG + Intronic
1137806341 16:51309562-51309584 CTTTATTAGAAGCATGAGAATGG + Intergenic
1138220677 16:55247799-55247821 CTTTATCAGCAGCATGAGAATGG - Intergenic
1138356022 16:56381004-56381026 CTTTATTAGCAGCATGAAAATGG - Intronic
1138714915 16:59009810-59009832 CTTTATTAGCAGCATAAGAATGG - Intergenic
1138861165 16:60759383-60759405 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1138962558 16:62044977-62044999 TTTTATTAGCAGCATGAGAATGG + Intergenic
1139104965 16:63817536-63817558 CTTCATCAGCAGCATGAAAACGG + Intergenic
1139172874 16:64651685-64651707 CTTTATTGGCAGCATGAGAATGG - Intergenic
1139254775 16:65530446-65530468 CTTTATTAGCAGCATAAGAATGG - Intergenic
1140147017 16:72320872-72320894 CTTTATTAGCAACATGAGAATGG - Intergenic
1140306245 16:73805922-73805944 CTTTATTAGCAGCCTGAGAATGG - Intergenic
1140552712 16:75884833-75884855 CTTTATTAGCAGCATGAGAATGG - Intergenic
1140649539 16:77071973-77071995 CTTTATTAGCAGCATGAGAATGG + Intergenic
1140781177 16:78298210-78298232 TCTTCTTAGCAGCATGAGAAGGG + Intronic
1141040747 16:80670529-80670551 CTTCATTAGCAACTTGAGAATGG + Intronic
1141214097 16:82008254-82008276 CTTTATTAGCAGTATGAGAATGG + Intronic
1141214388 16:82010156-82010178 TTTTATTAGCAGCATGAGAATGG + Intronic
1141235775 16:82214678-82214700 CTTCATTAGCAGCCTGAGAAGGG + Intergenic
1141322514 16:83025288-83025310 CTTTATTAGTAGCATGAGAATGG - Intronic
1141342857 16:83219056-83219078 CTTCATTAGCAGCATGAGAACGG + Intronic
1141793908 16:86256590-86256612 CCTCATTGTCAGCAGGGGGAGGG + Intergenic
1141902526 16:87001851-87001873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1142368158 16:89661526-89661548 CTTTATTAGCAGCATGAAAACGG + Intronic
1143760923 17:9103649-9103671 CTTTATTAGCAGCATGAGAATGG + Intronic
1144486663 17:15671682-15671704 CATCATTATCATCATGATGAGGG - Intronic
1144914356 17:18710615-18710637 CATCATTATCATCATGATGAGGG + Intronic
1145757725 17:27404925-27404947 CTTTATTAGCAGCATAAGAATGG - Intergenic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1148224403 17:45888441-45888463 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1149101128 17:52908424-52908446 CTTTATTAGCAGCATGAGAATGG + Intergenic
1149101959 17:52917880-52917902 CCTTATCAGCAGCATGAAAATGG + Intergenic
1149164023 17:53727917-53727939 CTTTATTAGCAGCATGAGAATGG - Intergenic
1149448389 17:56731462-56731484 CTTTATTAGCAGCATGAGAATGG + Intergenic
1150281753 17:63932962-63932984 ACTCTTTCACAGCATGAGGAAGG - Intergenic
1150506340 17:65702654-65702676 CTTTATTAGCAGCATGAGAATGG - Intronic
1150539609 17:66083403-66083425 CTTTATTAGCAGCATGAGAACGG + Intronic
1150579330 17:66457850-66457872 CTTTTTTAGCAGCATGAGAACGG + Intronic
1150830723 17:68517341-68517363 CTTTATTAGCAGCATGACAACGG - Intronic
1151058383 17:71060640-71060662 CTTTATTAGCAACATGAGAATGG + Intergenic
1151075332 17:71265870-71265892 CTTTATTAGCAGCATGAGAATGG - Intergenic
1151148933 17:72067038-72067060 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1151936814 17:77266938-77266960 CCTCACCAGCAGCCTGAGCAGGG - Intergenic
1152015121 17:77745521-77745543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1152203418 17:78960311-78960333 CCTCATTAGCATAAGTAGGATGG + Intergenic
1152915808 17:83034882-83034904 CCTCATCAGCAGCATGAAAACGG + Intronic
1153076132 18:1164266-1164288 CTTTATTAGCAGCATGAAAACGG - Intergenic
1153161963 18:2216558-2216580 CTTTATTAGCAGCATGAGAATGG + Intergenic
1153323822 18:3798100-3798122 CTTTATTAGCAGCATGAAAATGG + Intronic
1153362750 18:4216019-4216041 CTTTATTAGCAGCGTGAGAATGG - Intronic
1153763420 18:8353107-8353129 CCACTTCAGCAGCATAAGGAAGG + Intronic
1153763430 18:8353179-8353201 CCTCATCAGCTGCATCAGGCAGG - Intronic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1154977456 18:21473741-21473763 CCTTATTAGCACCATGAAAATGG - Intronic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1155420900 18:25654902-25654924 CCTTATTAGCAGAGTGAGAATGG - Intergenic
1155521766 18:26675357-26675379 TTTTATTAGCAGCATGAGAACGG + Intergenic
1155544610 18:26902595-26902617 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1155957423 18:31965561-31965583 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156130401 18:33965828-33965850 CTTTATTAGCAGCATAAGAATGG + Intronic
1156151441 18:34248866-34248888 CTTTATTAGCAGCATGAGAACGG - Intergenic
1156517644 18:37694623-37694645 TCTCCATAGCAGCATGAGAATGG - Intergenic
1156655763 18:39284090-39284112 CTTCATTAGCAGTGTGAGAATGG + Intergenic
1156988386 18:43376625-43376647 ATTTATTAGCAGCATGAGAACGG + Intergenic
1158322627 18:56280160-56280182 CTTCATTAGCAGCATGGGAATGG + Intergenic
1158595210 18:58810026-58810048 CTTCATTAGTAGCATGAGAATGG - Intergenic
1158701676 18:59754193-59754215 CTTTATTAGCAGCATGAAAACGG + Intergenic
1158743720 18:60173062-60173084 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159136258 18:64340646-64340668 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159183823 18:64944781-64944803 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159183902 18:64945399-64945421 CTTTATTAGCAGCACGAGAAAGG - Intergenic
1159453489 18:68631956-68631978 CTTTATTAGGAGCATGAGAATGG + Intergenic
1159492853 18:69161279-69161301 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159494922 18:69190184-69190206 CTTTATTAGCAGCATGAGAATGG + Intergenic
1159618004 18:70604005-70604027 CTTTATTAGCAGTATGAGAATGG - Intergenic
1159760394 18:72418926-72418948 CTTTATTAGCAGCATGAAAATGG + Intergenic
1159768086 18:72514846-72514868 CTTTATTAGCAGCATGAAAATGG - Intergenic
1159769041 18:72527088-72527110 CCTTATTAGCAGTGTGAGAACGG + Intergenic
1159839133 18:73376435-73376457 CTTTATTAGGAGCATGAGAATGG - Intergenic
1159888360 18:73931987-73932009 CTTTATTAACAGCATGAGAATGG + Intergenic
1160254596 18:77237263-77237285 CTTTATTAGCAGCCTGAGAATGG + Intergenic
1160294790 18:77628102-77628124 CTCTATTAGCAGCATGAGAATGG - Intergenic
1160435221 18:78846557-78846579 CCTTATTAGCAGTGTGAGAATGG + Intergenic
1160715740 19:575821-575843 ACCCATGAGCAGCAGGAGGAGGG - Intronic
1160753812 19:747608-747630 CCAAATTAGCACCAGGAGGAAGG - Exonic
1161998211 19:7727560-7727582 CTTTATTAGCAGCATGAGAACGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163229992 19:15995016-15995038 CTTTATTAGCAGCATGAGAATGG + Intergenic
1163472003 19:17502891-17502913 CTTTATTAGCAGCATGAGAATGG - Intronic
1164170358 19:22719677-22719699 CCTCATTATGAGCAGGATGAGGG + Intergenic
1164917277 19:32061985-32062007 CTTTATTAGCAGCATGAAAATGG + Intergenic
1164933572 19:32194287-32194309 CTTTATTAGTAGCATGAGAATGG - Intergenic
1166150533 19:40871013-40871035 TCTCTGTAGCAGCATGAGAACGG + Intronic
1166165044 19:40981556-40981578 CTTCATTAGCAGCATGAGAATGG - Intergenic
1166252852 19:41583490-41583512 CTTCATTAGCAGTGTGAGAATGG - Intronic
1166629341 19:44391392-44391414 CTTCATTAGCAACGTGAGAATGG - Intronic
1166727545 19:45037885-45037907 CCACTTCAGAAGCATGAGGAAGG - Exonic
1166862435 19:45818040-45818062 CCTCATGAGCAGCATGGGCAGGG + Exonic
1167003391 19:46759216-46759238 CTTTATTAGTAGCATGAGAAGGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
924976822 2:185021-185043 CTTTATTAGCAGCATGAGAATGG + Intergenic
925007616 2:456462-456484 CTTTATTAGCTGCATGAGAACGG - Intergenic
925035591 2:682880-682902 TCTCTATAGCAGCATGAGAATGG + Intergenic
925208779 2:2029263-2029285 CTTTATTAGCAGCATGCGAATGG - Intronic
925446726 2:3932704-3932726 CTTTATTAGCACCATGAGAATGG - Intergenic
925526862 2:4813027-4813049 CTTTATTAGCAGCATGAAAATGG - Intergenic
925737307 2:6975064-6975086 CTTTATTAGCAGCATGAAAATGG - Intronic
925796994 2:7556342-7556364 CTTTATTAACAGCATGAGAATGG - Intergenic
926280410 2:11441615-11441637 CTTTATTAGCAGCATGAGAATGG - Intergenic
926392114 2:12403917-12403939 CTTTATTAACAGCATGAGAAAGG + Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
926946465 2:18192667-18192689 CTTTATTAGCAGCATGAGAATGG + Intronic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
928025146 2:27733468-27733490 CTTCATTAGAAGCATGAGAATGG - Intergenic
928133789 2:28672837-28672859 CTTTATTATCAGCATGAGAATGG + Intergenic
928202112 2:29254245-29254267 CTTTATTAGCAGCATGAGAATGG + Intronic
928327547 2:30331842-30331864 CTTTATCAGCAGCATGAGAATGG + Intergenic
928593806 2:32842027-32842049 GCTCATTTCCAGCATGAGGCAGG + Intergenic
928694366 2:33834027-33834049 CTTTATTAGCAGCATGAGAATGG + Intergenic
928749683 2:34457370-34457392 CTTTATTAGCAGCATGAGAATGG - Intergenic
929043733 2:37771265-37771287 CTTTATTAGCAGCATGAGAAAGG + Intergenic
929211369 2:39360573-39360595 CTTTATTAGCAGCACGAGAATGG - Intronic
929387049 2:41421486-41421508 CTTTATTAGCAGCTTGAGAACGG + Intergenic
930269773 2:49242300-49242322 CTTTATTAGCATCATGAGTAGGG - Intergenic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930493093 2:52101810-52101832 CTTTATTAGCAGCATGAAAATGG - Intergenic
930507627 2:52304473-52304495 TTTTATTAGCAGCATGAGAATGG + Intergenic
930507902 2:52306464-52306486 CTTCATTAGCAGTGTGAGAATGG + Intergenic
930514723 2:52392678-52392700 CTTTATTAGCAGCATGAGAATGG - Intergenic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
930599987 2:53431992-53432014 CTTCATTAGCAGTGTGAGAATGG - Intergenic
930765119 2:55077322-55077344 TCTCTATAGCAGCATGAGAACGG + Intronic
931154796 2:59615768-59615790 CTTCATCAGCAGCATGAAAATGG - Intergenic
931952627 2:67382229-67382251 CTTTATTAGCAGCATGAAAATGG - Intergenic
932440828 2:71733771-71733793 CTTTGTTAGCAGCATGAGAATGG - Intergenic
932452364 2:71820606-71820628 CTTTATTAGTAGCATGAGAATGG - Intergenic
932987719 2:76747154-76747176 CTTTATTAGCAGCATGAGAATGG - Intergenic
933098926 2:78225872-78225894 CTTTATTAGCAGCATGAGAATGG - Intergenic
933251238 2:80031290-80031312 CTTTATTAGCAGCATGAAAATGG - Intronic
933284359 2:80369112-80369134 CCTCTTTGGAAGCTTGAGGAAGG - Intronic
933296046 2:80492390-80492412 TCTTAATAGCAGCATGAGAATGG + Intronic
933361641 2:81293877-81293899 CTTTATTAGCAGCATGAGAAGGG + Intergenic
933651444 2:84853240-84853262 CTTTATTAGCAGCGTGAGAACGG - Intronic
934169412 2:89327195-89327217 CATCCTCAGCAGCATGAGGTGGG - Intergenic
934197882 2:89855390-89855412 CATCCTCAGCAGCATGAGGTGGG + Intergenic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934960659 2:98669496-98669518 CTTTATTAGCAGCATGAAAATGG + Intronic
935206009 2:100896906-100896928 CCTTTATAGCAGCATGAGAATGG - Intronic
935372697 2:102364682-102364704 CTTTATTAGCAGCATGAGAATGG - Intronic
935865955 2:107387932-107387954 CTTTATTAGCAACATGAGAATGG + Intergenic
935868671 2:107420775-107420797 CTTTATTAGCAGCATGAGAATGG - Intergenic
936406016 2:112203663-112203685 CCTTATCAGCAGCATGAAAACGG - Intergenic
936718742 2:115222629-115222651 CCTTATCAGCAGCATGAAAATGG + Intronic
936721140 2:115254096-115254118 CTTTATTAGAAGCATGAGAATGG - Intronic
936754835 2:115695345-115695367 CTTTATTAGCTGCATGAGAACGG - Intronic
936811595 2:116408743-116408765 CTTTATTAGCAGCATGAAAATGG + Intergenic
936813902 2:116435829-116435851 CTTTATTAGCAGCGTGAGAACGG + Intergenic
936909532 2:117575975-117575997 CTTTATTAGCAGCATGGGAATGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937497854 2:122443172-122443194 CTTTATTAGCAGCATGAAAACGG - Intergenic
937607431 2:123818403-123818425 CTTTATTAGCAGCATGAGAATGG - Intergenic
937658447 2:124403726-124403748 CTTTATTAGCAGCATGAGACCGG - Intronic
937866730 2:126757636-126757658 CTTTATTAGCAGCCTGAGAATGG + Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
938974417 2:136462070-136462092 CTTTATTAGCAGCATGAGAACGG - Intergenic
939094630 2:137820739-137820761 CTTTGTTAGCAGCATGAGCATGG - Intergenic
939423268 2:142001203-142001225 CTTTATCAGCAGCATGAGAATGG + Intronic
939780914 2:146446479-146446501 CTTTATTAGCAGCATGAGAATGG - Intergenic
940161146 2:150714904-150714926 CTTTATTAGCAGCATGAAAATGG - Intergenic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
940483985 2:154274718-154274740 CTTTATTAGCAGCATGAGAATGG + Intronic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
940621893 2:156122770-156122792 CCTTTATAGCAGCATGAGAATGG + Intergenic
940640929 2:156343076-156343098 CCGTAGTAGCAGCGTGAGGAAGG + Intergenic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941067965 2:160924653-160924675 CTTTATTAGCAGCATGAGAATGG - Intergenic
941398346 2:164999575-164999597 CTTCATCAGCAGCATGAAAACGG - Intergenic
941468758 2:165859769-165859791 CTTTATTAGCAGCATGAAAATGG - Intronic
941512911 2:166436502-166436524 CCTTATTAGCATCATGACAATGG + Intronic
941513169 2:166438408-166438430 CTTTATTAGCAGCATGAGAGTGG + Intronic
941607829 2:167621983-167622005 CTTTATTAGCAGCATGAGAATGG + Intergenic
942733476 2:179083617-179083639 CTTTATTAGCAGCATGAGAAAGG - Intergenic
942846272 2:180429442-180429464 CTTTATTAGCAGCATGAGAATGG - Intergenic
942950356 2:181714034-181714056 CTTTATTAGCAGCGTGAGAACGG + Intergenic
943006388 2:182392114-182392136 CTTTATTAGCAGCATAAGAATGG - Intronic
943006663 2:182394140-182394162 CTTTATTAGCAGCGTGAGAATGG - Intronic
943010365 2:182440963-182440985 CTTTATTAGTAGCATGAGAATGG - Intronic
943017179 2:182528005-182528027 CTTCATCAGCAGCATGAAAATGG + Intergenic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943123992 2:183773335-183773357 CTTTATCAGCAGCATGAGAACGG + Intergenic
943183526 2:184575650-184575672 CTTTATTAGCAGCCTGAGAACGG - Intergenic
943220273 2:185094882-185094904 CTTTATTAGCAGCATAAGAATGG + Intergenic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943238194 2:185348794-185348816 CTTTATTAGCAGCATGAGAATGG + Intergenic
943289464 2:186050328-186050350 CTTTATTAGCAGCATGAGAATGG - Intergenic
943502345 2:188707465-188707487 CTTTATTAGCAGCATGAGAACGG + Intergenic
943701790 2:190995302-190995324 CTTTATTAGCAGCATGAGAATGG - Intronic
943746855 2:191471240-191471262 CCTTATTAGCAGCATGAAATGGG + Intergenic
943794432 2:191974018-191974040 TCTTATTAGCAGAATGAGAATGG + Intronic
943814984 2:192242096-192242118 CTTTAATAGCAGCATGAGAATGG - Intergenic
943850607 2:192717482-192717504 CTTTATTAGCAGCATGAGAACGG - Intergenic
943938999 2:193965662-193965684 CTTTACTAGCAGCATGAGAACGG + Intergenic
944222848 2:197319778-197319800 CCTTTATAGCAGCATGAGAATGG - Intergenic
944458279 2:199917838-199917860 CTCTATTAGCAGCATGAGAATGG - Intronic
944475144 2:200095843-200095865 CTTTATTAGCAGCGTGAGAATGG + Intergenic
944516585 2:200518196-200518218 CTTTATTGGCAGCATGAGAACGG + Intronic
944862450 2:203827916-203827938 CTTTATTAGCAGCATGAAAATGG + Intergenic
944937842 2:204588013-204588035 CTTTATTAGCAGCATGAGAATGG + Intronic
945123630 2:206485067-206485089 CTTTATGAGCAGCATGAGAATGG + Intronic
945347326 2:208733407-208733429 CCTTATTAGCAGCATGATAACGG - Intronic
945593779 2:211767481-211767503 CTTTATTAGCAGCATGAGAACGG - Intronic
945643424 2:212460235-212460257 CTTTATTAGCAGCATGAAAATGG + Intronic
945797909 2:214387583-214387605 CTTTATTAGCAGCGTGAGGATGG - Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
946466083 2:219913420-219913442 CTTTATTAGCAGCATGAAAACGG - Intergenic
946472367 2:219974202-219974224 CATTATTAGCAGCGTGAGAACGG - Intergenic
946477155 2:220018136-220018158 CTTTATTAGCAGCATGAGAACGG + Intergenic
946657074 2:221960145-221960167 CCTTTTTAGCAGCATGAGAATGG - Intergenic
946677080 2:222171505-222171527 CTTTATTAGCAGCATGAGAATGG + Intergenic
946732086 2:222719802-222719824 CTTTATTAGAAGCATGAGAATGG - Intergenic
946769781 2:223076981-223077003 CTTTATTAGCAGCATGAGAAAGG - Intronic
946849328 2:223889702-223889724 CTTTATTAGCAGCCTGAGAATGG + Intronic
946939625 2:224757434-224757456 CTTTATTAGCAGCATGAAAATGG + Intergenic
946974540 2:225133807-225133829 CTTTATCAGCAGCATGAGAATGG - Intergenic
947071619 2:226293762-226293784 CTTTATTAGCAACATGAGAACGG + Intergenic
947166316 2:227265772-227265794 CTTTATTAGCAGCATGAGAATGG - Intronic
947349264 2:229225618-229225640 CTTTATTAGCAGCATGGGAAGGG - Intronic
947396865 2:229695234-229695256 CTTTATTAGCAGCATGAGAATGG + Intronic
947529216 2:230898241-230898263 CATCACTGGCAGCCTGAGGATGG - Intergenic
947535236 2:230935969-230935991 CATCAGTATCAGCATGAGGGAGG + Intronic
947535315 2:230936585-230936607 GTTTATTAGCAGCATGAGAATGG + Intronic
948007743 2:234624268-234624290 CTTTATTAGCAGCATGAGAATGG + Intergenic
948662623 2:239516448-239516470 CCTCATGAGCACCACGAAGATGG - Intergenic
949071727 2:242029236-242029258 CCTCATAAGCTGCATGGGAATGG + Intergenic
1168918681 20:1512912-1512934 CTTTATTAGCAGCATAAGAATGG - Intergenic
1169006588 20:2212461-2212483 ACTCATTAGCAGAATGTGTAAGG - Intergenic
1169544877 20:6639872-6639894 CTTCATTAGCAGTGTGAGAATGG - Intergenic
1169609566 20:7363913-7363935 CTTTATTAGCAGCATGAAAATGG + Intergenic
1169742693 20:8912452-8912474 CCTTTATAGCAGCATGAGAATGG + Intronic
1169817930 20:9678253-9678275 CTTTATTAGCAGTATGAGAATGG - Intronic
1169836795 20:9889289-9889311 CTTTATTAGCAGCATGAGAACGG - Intergenic
1170286448 20:14715009-14715031 CTTTATTAGCAGCATGAGAATGG - Intronic
1170341022 20:15327361-15327383 CTTTATTAGCAGCATGAGAATGG - Intronic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1170636578 20:18110691-18110713 TCTCATTAGGAGCAGGAGCAAGG - Intergenic
1171564480 20:26167854-26167876 CCTCAGCAGCCACATGAGGAGGG + Intergenic
1171750011 20:29039572-29039594 CTTTATTAGCAGCATGAGAATGG - Intergenic
1172378413 20:34466188-34466210 CCACATTAACAGAATGAGGGGGG - Intronic
1172576202 20:36010796-36010818 TCTCATGCTCAGCATGAGGAAGG - Intronic
1172699272 20:36843021-36843043 TCCCAGTGGCAGCATGAGGAGGG - Intronic
1172716780 20:36970179-36970201 CTTTATTAGCAGCTTGAGAACGG - Intergenic
1173213262 20:41054473-41054495 CTTTATTAGCAGCGTGAGAATGG + Intronic
1173323246 20:42008984-42009006 CTTTATTAGCAGCATGAGAATGG - Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1174444044 20:50578616-50578638 CCTCCTTACCAGCAAGAGGCAGG - Exonic
1174514358 20:51080088-51080110 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1174530675 20:51210895-51210917 CTTTAATAGCAGCATGAGAATGG + Intergenic
1175230966 20:57472954-57472976 CTTTATTAGCAGCATGAGAATGG + Intergenic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1176315207 21:5236344-5236366 CTTTATTAGCAGCATGAGAATGG + Intergenic
1176359328 21:5981919-5981941 CTTTATTAGCAGCGTGAGAAAGG + Intergenic
1176677377 21:9791824-9791846 GTTTATTAGCAGCATGAGAATGG + Intergenic
1176745550 21:10649142-10649164 CTTTATTAGCAGCATGATAATGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1176987035 21:15449103-15449125 CTTTATTAGCAGCTTGAGAATGG + Intergenic
1177008163 21:15699508-15699530 CTTTATTAGCGGCATGAGAATGG - Intergenic
1177017819 21:15814306-15814328 CTTTATTAGCAGCTTGAGAATGG + Intronic
1177130330 21:17247580-17247602 CTTCATCAGCAGCATGAATACGG + Intergenic
1177265899 21:18783609-18783631 CTTCATTAGCAGTGTGAGAACGG - Intergenic
1177323734 21:19556510-19556532 CTTTATTTGCAGCATGAGAACGG - Intergenic
1177418555 21:20826242-20826264 CTTTATTAGCAGCATGAGACTGG - Intergenic
1177484304 21:21737178-21737200 CTTTATTAGCAGCATGAGAACGG - Intergenic
1177521933 21:22237969-22237991 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177614530 21:23499996-23500018 CTTTATTAGCAGCATGAAAAAGG - Intergenic
1177854363 21:26384599-26384621 CTTTATTAGCAGCATGAGAATGG + Intergenic
1178114542 21:29404175-29404197 CTTTATTAGCAGCATGAGAAGGG + Intronic
1178274942 21:31228731-31228753 CTTTGTTAGCAGCATGAGAATGG - Intronic
1178341049 21:31785499-31785521 CTTAATTAGCAGCATGAGAATGG - Intergenic
1178362465 21:31960506-31960528 CTTTATTAGCAGCATGAGAATGG - Intronic
1178475565 21:32934373-32934395 CCTCATTAACTGCCTGAAGAAGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1178745956 21:35250562-35250584 CTTTATCAGCAGCATGAGAATGG + Intronic
1178911062 21:36674150-36674172 CTTTATTAGCAGCATGAAAACGG - Intergenic
1179052841 21:37903462-37903484 CTTTGTTAGCAGCATGAGAATGG + Intronic
1179382715 21:40914397-40914419 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1179484646 21:41702074-41702096 TGTTATTAGCAGCATGAGAACGG - Intergenic
1179764190 21:43556631-43556653 CTTTATTAGCAGCGTGAGAAAGG - Intronic
1179793966 21:43771611-43771633 CTTTATTAGCAGCATGAGAATGG - Intergenic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1180218189 21:46339995-46340017 CTTTATTAGCAGCATGAGAATGG - Intronic
1180392995 22:12302298-12302320 CTTTATTAGCAGCATGAGAATGG + Intergenic
1180406755 22:12562470-12562492 CTTTATTAGCAGCATGAGAATGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180723084 22:17923841-17923863 CTTTATTAGCAGCATGAGAATGG - Intronic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1182207126 22:28639790-28639812 CTTCATCAGCAGCATGAAAACGG + Intronic
1182799912 22:33023510-33023532 CTTTATTGGCAGCATGAGAATGG + Intronic
1182862405 22:33571385-33571407 CCAGATTAGCAGTATGAGCATGG + Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1183801139 22:40165574-40165596 CTTTATTAGCAGCATGAGAATGG - Intronic
1184481191 22:44748358-44748380 CTTCATCAGCAGCGTGAGAATGG + Intronic
1184862231 22:47179108-47179130 CTTTATTAACAGCATGAGAATGG + Intergenic
1203295867 22_KI270736v1_random:42677-42699 CTTTATTAGCAGCATGAGAATGG + Intergenic
949420843 3:3864325-3864347 CTTCATTAGCAGTGTGAGAATGG - Intronic
949474044 3:4425731-4425753 CTTTATTAGCAGCATGAGAATGG - Intronic
949858979 3:8488192-8488214 CTTTATTAGCAGCGTGAGAATGG + Intergenic
950917644 3:16662321-16662343 CTTTATTAGCAGCTTGAGAAAGG + Intronic
951037821 3:17952637-17952659 CCTTTATAGCAGCATGAGAATGG + Intronic
951291988 3:20882518-20882540 CTTTATTAGCAGCATGAGAATGG - Intergenic
951307720 3:21086209-21086231 TCTTATTAGCAGCATAAGAATGG - Intergenic
951446663 3:22789377-22789399 CTTAACTAGCAGCATGAGAATGG + Intergenic
951799604 3:26580997-26581019 CCTTTATAGCAGCATGAGAATGG - Intergenic
951947696 3:28159473-28159495 CTTTATTAGCAGCATGAGAATGG + Intergenic
952134998 3:30408563-30408585 CTTTATTAGCAGCATGAGAAAGG + Intergenic
952169578 3:30792035-30792057 CTTTACTAGCAGCATGAGAACGG + Intronic
952187988 3:30991959-30991981 CTTTATTAGCAGCGTGAGAATGG - Intergenic
952538874 3:34345175-34345197 CTTCATTAGCAGCATGAGAACGG + Intergenic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953229731 3:41054153-41054175 CTTTATTAGCAGCATGAGAATGG - Intergenic
953826752 3:46259900-46259922 CTTCATCAGCAGCATGAAAATGG - Intronic
955485903 3:59434111-59434133 CCTTTATAGCAGCATGAGAAGGG + Intergenic
955763455 3:62314954-62314976 CTTCATTAGCAGTGTGAGAATGG - Intergenic
956058574 3:65326569-65326591 CTTTATTAGCAGCGTGAGAATGG + Intergenic
956300954 3:67771842-67771864 ACTCATTAGCAGCATAATAATGG - Intergenic
956346192 3:68281897-68281919 CTTTATTAGCAGCGTGAGAATGG - Intronic
956348973 3:68312833-68312855 CTTCATCAGCAGCATGAAAATGG - Intronic
956849118 3:73212192-73212214 CTTTATTAGCAGCATGAGAATGG - Intergenic
957267308 3:77983719-77983741 CTTTATTAGCAGCATGAGAATGG - Intergenic
957360589 3:79151239-79151261 CTTTATTAGCAGCATGAGAATGG + Intronic
957475835 3:80722610-80722632 CTTTATTTGCAGCATGAGAATGG + Intergenic
957779329 3:84798100-84798122 CCTTATTAGTAGCGTGAGAACGG + Intergenic
957834878 3:85574353-85574375 CCTCATTAGCAGCACAAAGCTGG - Intronic
958076836 3:88691130-88691152 CTTTATCAGCAGCATGAGAACGG - Intergenic
958468292 3:94485272-94485294 CTTTATTAACAGCATGAGAATGG - Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
958563959 3:95782660-95782682 CTTTATTAGCAGTATGAGAAAGG + Intergenic
958611734 3:96435677-96435699 CTTTATTAGCAGCATGAACATGG - Intergenic
958637368 3:96762650-96762672 CTTTATTAGCAGCATGAGAATGG + Intergenic
958886368 3:99732302-99732324 CTTTATTAGCAGCATGAGAAGGG - Intronic
959033224 3:101327570-101327592 CTTTATTAGCAGCATGAGAACGG + Intronic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959139878 3:102472870-102472892 CTTTATTAGCAGCATGAGAATGG - Intronic
959247029 3:103884323-103884345 CTTTATTAGAAGCATGAGAATGG - Intergenic
959741960 3:109730868-109730890 CTTTATTAGCAGCATGAGAATGG - Intergenic
959810171 3:110608807-110608829 CCACATTAACAAAATGAGGAAGG + Intergenic
959914307 3:111798879-111798901 CTTTATTAGCAGCATGAGAGTGG - Intronic
960070697 3:113426649-113426671 GTTTATTAGCAGCATGAGAACGG + Intronic
960099481 3:113725015-113725037 CTTTATTAGCAGCATGAGAAAGG + Intronic
960129071 3:114034060-114034082 GCTCATTTTCTGCATGAGGATGG + Intronic
960217320 3:115057842-115057864 CTTTATTAGCAGCATGAGAACGG - Intronic
960262815 3:115587956-115587978 CATCATTAGGAGAATGAGCAGGG - Intergenic
960430378 3:117561342-117561364 CTTTATTAGCAGCATGAGAATGG + Intergenic
960478167 3:118157253-118157275 CTTTATTAGCAGTATGAGAATGG - Intergenic
960478486 3:118159669-118159691 CTTTATTAACAGCATGAGAACGG + Intergenic
960501900 3:118447994-118448016 CTTTATTAGCAGCATGAGAATGG - Intergenic
960564521 3:119119188-119119210 CTTCATCAGCAGCATGAAAATGG - Intronic
960793885 3:121463420-121463442 CTTTATTAGCAGCATGACAACGG + Intronic
961155909 3:124679435-124679457 CTTGATTGGCAGCATGAGGAAGG - Intronic
961777321 3:129297710-129297732 GCTTATTGGCAGCATCAGGAGGG - Intronic
962067161 3:131993021-131993043 CTTTATTAGCAGCATGAGAATGG + Intronic
962646536 3:137445991-137446013 CTTTATTAGCAGCATGAGAATGG - Intergenic
962684909 3:137837992-137838014 CTTTATTAGCAGCATGAGAAGGG + Intergenic
963339608 3:144019104-144019126 CTTTATTAGCAGCATGAGAATGG - Intronic
963744558 3:149113512-149113534 CCTTATCAGCAGCATGAAAACGG - Intergenic
964009954 3:151880767-151880789 ACTCCTTATCAGCATGGGGAGGG - Exonic
964090970 3:152874944-152874966 CCTTATTAGCAGCATGAGAATGG - Intergenic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
964525363 3:157611220-157611242 CTTTATTAGCAGCATGAGAACGG + Intronic
964737925 3:159935157-159935179 CTTTATTAGTAGCATGAGAATGG - Intergenic
964895647 3:161591593-161591615 CCTTATTAGCAGCATGAGAATGG - Intergenic
964954326 3:162334085-162334107 CTTTATTAGCAGCATGAGAATGG + Intergenic
964954665 3:162337879-162337901 TCTCATTAGTTGCAGGAGGAAGG - Intergenic
965224715 3:165973079-165973101 CTTTATTAGCAGCATAAGAACGG + Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
965637393 3:170797580-170797602 TCTTCTTAGCAGCATGAGAATGG - Intronic
965931257 3:174045033-174045055 CCTTTATAGCAGCATGAGAATGG + Intronic
965931271 3:174045177-174045199 CTTTATTAGCAGCATGAAAACGG - Intronic
965957250 3:174386234-174386256 CTTTATTAGCAGCATGAAAATGG - Intergenic
966311187 3:178595774-178595796 CTTTATTAGCAGCATGAGAACGG + Intronic
966314939 3:178634297-178634319 CCTTATTAGCAGTGTGAGAACGG - Intronic
966343337 3:178949939-178949961 CTTTATTAGCAGCATGAGAACGG + Intergenic
966968767 3:185022311-185022333 TCTTAATAGCAGCATGAGAATGG + Intronic
967634860 3:191789868-191789890 CTTTATTAGCAGCACGAGAATGG - Intergenic
967640922 3:191862110-191862132 CTTTATTAGCAGCATGAGAATGG - Intergenic
967749739 3:193100427-193100449 CTTTATTAGCAGCGTGAGAATGG + Intergenic
967957158 3:194886128-194886150 CTTTATTAGCAGCCTGAGAATGG - Intergenic
968228572 3:196991072-196991094 CTTTATTAGCAACATGAGAACGG - Intronic
968284822 3:197502334-197502356 TCTCATTAACAGGATGAAGAAGG - Intergenic
969041074 4:4296633-4296655 CCTTATCAGCAGCATGAAAACGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969960385 4:10939345-10939367 CTTTATTAGCAGCATGAGAATGG + Intergenic
970076472 4:12227506-12227528 CCTTATTAGCAGCAGGAGAATGG - Intergenic
970094310 4:12445264-12445286 CTTTATTAGCAGCATGAAAATGG - Intergenic
970560708 4:17279571-17279593 CTTTATCAGCAGCATGAGAATGG - Intergenic
970562423 4:17295770-17295792 CTTCATTAGCAACATGACAATGG - Intergenic
970644014 4:18098654-18098676 CTTTATTAGCAGCATGAGAACGG - Intergenic
970780702 4:19734343-19734365 CTTCATTAGCAGCATGAGAACGG - Intergenic
970985766 4:22155566-22155588 CTTTATTAGCAGCATGAGAATGG + Intergenic
971484690 4:27147293-27147315 CTTTATCAGCAGCATGAGAATGG - Intergenic
971534349 4:27730100-27730122 AGTTATTAGCAGCATGAGAATGG - Intergenic
971793460 4:31198361-31198383 CTTTATTAGCAGCATGAAAATGG - Intergenic
972017498 4:34264411-34264433 CTTTATTAGCAGCATGAGAATGG - Intergenic
972113355 4:35594639-35594661 CTTCATTAGCAGCGTGAAAATGG - Intergenic
972381050 4:38520777-38520799 CTTTATTAGCAGCATGAAAACGG + Intergenic
972678089 4:41279598-41279620 CTTTATTAGCAGGATGAGAACGG - Intergenic
972835671 4:42867094-42867116 CTTTATTAGCAGCGTGAGAATGG + Intergenic
972835675 4:42867144-42867166 CTTTATTAGCAGCGTGAGAATGG + Intergenic
972900923 4:43682413-43682435 CTTTATTAGCAGCATGAGAATGG - Intergenic
972966784 4:44520183-44520205 CTTTATTAGCAGCATGAAAATGG - Intergenic
973588055 4:52412135-52412157 CTTCATCAGCAGCATGAAAACGG - Intergenic
973641851 4:52911005-52911027 CTTTATTAGCAGCATGAGAACGG + Intronic
973909508 4:55565305-55565327 CTTTATTAGCAGCATGAGAACGG - Intronic
973969081 4:56192992-56193014 CTTTATTAGCAGCATGAGAATGG - Intronic
974045254 4:56893003-56893025 CTTTATTAGCATCATGAGAATGG - Intergenic
974255054 4:59441808-59441830 CTTTATTAGCAGCATGAGAATGG + Intergenic
974445593 4:61976838-61976860 CTTTATCAGCAGCATGAGAATGG + Intronic
974517369 4:62935321-62935343 CCTTATCAGCAGCATGAAAATGG + Intergenic
974642272 4:64646553-64646575 CTTTATTAGCAGCATGAAAATGG - Intergenic
974925425 4:68292183-68292205 CTTTATTAGCAGCATGAGAATGG - Intergenic
975037101 4:69697689-69697711 CTTTATTAGCAGCATGACAATGG - Intergenic
975064633 4:70045489-70045511 TCTTCTTAGCAGCATGAGAACGG - Intergenic
975257452 4:72254819-72254841 CTTTATTAGCAGCATGAAAATGG + Intergenic
975390947 4:73816698-73816720 CCTTATCAGCAGCATGAAAACGG + Intergenic
975495258 4:75029637-75029659 CTTTGTTAGCAGCATGAGAATGG + Intronic
975722620 4:77262894-77262916 TCTCATGAGCAGCATCAGCATGG - Intronic
975804426 4:78097434-78097456 CTTTATTAGCAGCATGAAAATGG - Intronic
975918090 4:79348300-79348322 CTTCATCAGCAGCATGAAAATGG + Intergenic
976002887 4:80392720-80392742 CTTTATTAGCAGCATGAGAATGG + Intronic
976366414 4:84237721-84237743 CTTTATTAGCAGCATGAGAACGG + Intergenic
976932763 4:90588925-90588947 CTTTATCAGCAGCATGAGAATGG + Intronic
976975057 4:91155448-91155470 CTTTATTAGCAGCATGAGAACGG + Intronic
977122135 4:93115583-93115605 CCTTATCAGCAGCATGAGAATGG - Intronic
977284156 4:95081276-95081298 CGTTATTAGCAGCGTGAGAACGG + Intronic
977356243 4:95951469-95951491 CTTTATTAGCAGCATGAGAATGG - Intergenic
978044827 4:104113590-104113612 CTTTATTAGCAGCATGAGAATGG - Intergenic
978687013 4:111457836-111457858 CTTTATTCGCAGCATGAGAATGG + Intergenic
978902072 4:113963265-113963287 CCTTTATAGCAACATGAGGATGG - Intronic
979126110 4:116973800-116973822 CTTTATTAGCAGCATGAGAATGG + Intergenic
979511362 4:121557414-121557436 TTTTATTAGCAGCATGAGAATGG + Intergenic
979594521 4:122519527-122519549 CCTTATTAGCAGCATGAAAATGG + Intergenic
979895986 4:126157519-126157541 TTTTATTAGCAGCATGAGAATGG - Intergenic
980161105 4:129164144-129164166 CTTTATTAGCAGCATGAGAATGG - Intergenic
980199162 4:129632733-129632755 CCTCATCAGCAGCATGAAAATGG - Intergenic
980201403 4:129659723-129659745 CTTTATTAGCAGCATGACAATGG - Intergenic
980432040 4:132713897-132713919 CTTTATTAGCAGCATGAGAATGG - Intergenic
981285581 4:143015353-143015375 CTTTATTAGCAACATGAGAATGG - Intergenic
981335881 4:143568548-143568570 CTTCATTAGTAGCATGAGAATGG - Intergenic
981483688 4:145262957-145262979 CTTTATTAGCAGCATGAAAAAGG + Intergenic
981834255 4:149036786-149036808 CACTATTAGCAGCATGAGAATGG + Intergenic
982050789 4:151499601-151499623 CTTTATTAGCAGCATGAGAGTGG - Intronic
982252304 4:153419683-153419705 CTTTATTAGCAGCGTGAGAACGG - Intergenic
983317328 4:166148951-166148973 CCTTTATAGCAGCATGAGAATGG + Intergenic
983595359 4:169460180-169460202 CCTTATCAGCAGCATGAAAACGG - Intronic
983889664 4:173017176-173017198 CTTTATTAGCAGCATGAGAATGG + Intronic
984150942 4:176129574-176129596 CATCATTAAAAGCATGGGGAAGG + Intronic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
984286479 4:177735969-177735991 CTTTATTAGCAGCATGAGAATGG + Intronic
984410037 4:179386295-179386317 CTTTATTAGCAGCATGAAAATGG - Intergenic
984571285 4:181397395-181397417 CTTTATTAGCAGCATGAGAGTGG - Intergenic
984722684 4:182990583-182990605 CCTTATTAGCAGTGTGAGAATGG + Intergenic
984841409 4:184071358-184071380 CTTTATCAGCAGCATGAGAATGG - Intergenic
985110139 4:186539924-186539946 CTTTATCAGCAGCATGAGAATGG - Intronic
985398159 4:189566957-189566979 GTTTATTAGCAGCATGAGAATGG - Intergenic
985431923 4:189889221-189889243 CTTTATTAGCAGCATGAGAATGG - Intergenic
985788502 5:1912481-1912503 CTTTATTAGCAGCATGAGAACGG + Intergenic
986077435 5:4352567-4352589 CTTTATTAGCAGCATGAGAATGG - Intergenic
986106735 5:4666995-4667017 CTTTATTAGCAGCATGAGAAGGG - Intergenic
986171057 5:5314989-5315011 CTTCATTAGCAGCGTGAGAATGG - Intronic
986640456 5:9867284-9867306 CTTTATTAGCAGCATGAGAGTGG - Intergenic
986640727 5:9869223-9869245 CTTTATTAGCAGCATGAGAATGG - Intergenic
986844402 5:11735860-11735882 CTTTATTAGCAGCATGAGAATGG + Intronic
987038798 5:14042631-14042653 CTTTATTAGCAGCGTGAGAACGG + Intergenic
987102086 5:14600374-14600396 CTTTATTAGCAGCATGAGAATGG + Intronic
987153714 5:15066848-15066870 CTTTATTAGCAGCATGAGAATGG - Intergenic
987194921 5:15516956-15516978 CTTTATTAGCAGCGTGAGAACGG + Intronic
987457879 5:18169573-18169595 CTTTATTAGCAGCATGAGAATGG + Intergenic
987481154 5:18459485-18459507 CTTTATTAGCAGCATGAGAATGG + Intergenic
987593433 5:19963728-19963750 CTTTATTAGCAGCATGAGAATGG + Intronic
987610829 5:20200029-20200051 TCTTCATAGCAGCATGAGGAAGG + Intronic
987642222 5:20627844-20627866 CTTTATTAGCAGCATGAGAACGG - Intergenic
987680665 5:21132652-21132674 CTTTATCAGCAGCATGAGAATGG + Intergenic
987741798 5:21918411-21918433 CTTTATTAGCAGCATGAGAATGG - Intronic
987814373 5:22881638-22881660 CTTTATTAGCAGCATGAGAATGG - Intergenic
988042293 5:25905195-25905217 CTTTATTAGCAGCATGAGAATGG - Intergenic
988289418 5:29266663-29266685 CTTTATTAGCAGCATGAGAATGG - Intergenic
988356878 5:30187942-30187964 CTTTATTAGCAGCATGAGAATGG + Intergenic
988523437 5:31966011-31966033 CATGATGAGCAGCATTAGGATGG + Intronic
988834975 5:35023242-35023264 CTTTATCAGCAGCATGAGAAAGG + Intronic
989155520 5:38341198-38341220 CTTTATTAGCAGCGTGAGAACGG - Intronic
989340333 5:40367292-40367314 CTTTATTAGCAGCATAAGAAAGG - Intergenic
989354822 5:40531856-40531878 CTTCATCAGCAGCATGAAAATGG - Intergenic
989523753 5:42429059-42429081 CTTTGTTAGCAGCATGAGAATGG - Intronic
989603220 5:43219347-43219369 CTTTATTAGCAGCATGAGAAAGG + Intronic
989747860 5:44852824-44852846 CTTTATTAGCAGCATGAGAATGG - Intergenic
989791158 5:45403338-45403360 CTTTATTAGCAGCCTGAGAATGG - Intronic
990080454 5:51906487-51906509 CTTTATTAGCATCATGAGAATGG + Intergenic
990117384 5:52405141-52405163 CTTTATTAGCAGCATGAGAACGG + Intergenic
990215019 5:53521305-53521327 CTTTATTAGCAACATGAGAATGG - Intergenic
990279743 5:54237368-54237390 CTTTATTAGCAGCATGAGAATGG + Intronic
990363243 5:55042862-55042884 CTTCATCAGCAGCATGAAAATGG + Intergenic
990497603 5:56364134-56364156 CTTTATTAGCAGCATGAGAATGG + Intergenic
990632422 5:57684688-57684710 CCTTTATAGCAGCATGAGAATGG + Intergenic
990861194 5:60329489-60329511 CTTTATTAGCAGCATGAGAATGG + Intronic
991049070 5:62253383-62253405 CTTTATTAGCAGCGTGAGAATGG + Intergenic
991169297 5:63602111-63602133 CCTTATCAGCAGCATGAAAACGG + Intergenic
991586726 5:68209853-68209875 CCTTATTAGCAGCATGAAAATGG - Intergenic
991770808 5:70039268-70039290 CTTTATTATCAGCATGAGAACGG - Intronic
991850102 5:70914685-70914707 CTTTATTATCAGCATGAGAACGG - Intronic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992335683 5:75766327-75766349 CCTTATCAGCAGCATGAAAATGG + Intergenic
992386168 5:76286633-76286655 CTTTATTAGCAGCATGAAAATGG - Intronic
992414269 5:76538000-76538022 CTTTATTAGCATCATGAGAATGG - Intronic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
993631430 5:90290713-90290735 CCTCATTACAAGCATAATGAAGG + Intergenic
993723769 5:91346472-91346494 CTTCATCAGCAGCATGAAAACGG - Intergenic
993761142 5:91799220-91799242 CTTTATTAGCAGCATGAGAATGG - Intergenic
993823493 5:92650949-92650971 ACTCATTAGCTGCATTAGTAAGG - Intergenic
993884157 5:93396837-93396859 TCTCCATAGCAGCATGAGAATGG + Intergenic
993993052 5:94684346-94684368 CCTCAGTAGTAGCAAGAGAACGG + Intronic
994524360 5:100883892-100883914 CCTTATCAGCAGCATGAAAATGG + Intronic
994542434 5:101116888-101116910 CTTTGTTAGCAGCATGAGAATGG + Intergenic
994578474 5:101610555-101610577 CTTTATTAGCAGCATGAGAATGG - Intergenic
994666358 5:102710018-102710040 CTTCATCAGCAGCATGAAAATGG + Intergenic
994715710 5:103319044-103319066 CTTTATTAGCAGCGTGAGAACGG + Intergenic
995050189 5:107694615-107694637 CTTTATTAGCAGCATGAGAACGG - Intergenic
995065653 5:107858789-107858811 CCCTTTTAGCAGCATGAGAATGG + Intergenic
995429001 5:112053925-112053947 CTTTATTAGCAGCATGAGAATGG + Intergenic
995479449 5:112580356-112580378 CCCCATGAGCACCAAGAGGATGG + Intergenic
995607726 5:113875611-113875633 CCACATGAGCAGCATGAGAAGGG + Intergenic
995926232 5:117378493-117378515 CTTTATTAGTAGCATGAGGATGG + Intergenic
996006703 5:118429731-118429753 CTTTATTAGCAGCATGAGAATGG - Intergenic
996042129 5:118827136-118827158 CTTTATTAGCAGCATGAGAATGG - Intergenic
996073833 5:119165570-119165592 CTTTATTAGCAGCATGAAAACGG - Intronic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
996179863 5:120406275-120406297 CTTTATTAGCAGCATGAAAATGG + Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
996256039 5:121403741-121403763 TCTTTTTAGCAGCATGAGAATGG + Intergenic
997056841 5:130453579-130453601 CTTTATTAGCAGCATGAAAATGG - Intergenic
997620031 5:135281982-135282004 CTTTATTAGCAGCATGAACACGG + Intronic
999575492 5:152972199-152972221 CTTCATCAGCAGCATGAAAAAGG - Intergenic
1000612335 5:163388015-163388037 CTTTATTAGCAGCATGAGAAGGG - Intergenic
1000624611 5:163525027-163525049 CTTTATTAGCAGCATGAGAATGG - Intergenic
1000639312 5:163682695-163682717 CTTTATTAGCAGCATGAAAATGG + Intergenic
1000690992 5:164320694-164320716 CTTTATTAGGAGCATGAGAATGG - Intergenic
1000746294 5:165037913-165037935 CTTTATTAGCAGCATGAAAATGG + Intergenic
1000788166 5:165571518-165571540 TCTCCCTAGCAGCATGAGAATGG - Intergenic
1001054593 5:168438548-168438570 CTTTATTAGCAGCATGAGAACGG + Intronic
1001418089 5:171562795-171562817 CTTCATTAGCAGCATAAGAATGG - Intergenic
1001663908 5:173416700-173416722 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1001694827 5:173662137-173662159 CTTTATCAGCAGCATGAGAATGG - Intergenic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1002672311 5:180878102-180878124 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1002961893 6:1923174-1923196 CTTTATCAGCAGCATGAGAACGG + Intronic
1003203324 6:3984017-3984039 CTTCATCAGCAGCATGAAAATGG + Intergenic
1003373836 6:5555301-5555323 CTTCATCAGCAGCATGAAAACGG + Intronic
1004245799 6:13973761-13973783 CTTTATTAGCAGCATGAGAATGG + Intronic
1004299661 6:14445686-14445708 CATCATTATTAACATGAGGAAGG - Intergenic
1004467970 6:15903489-15903511 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1004700531 6:18075294-18075316 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1004813629 6:19288322-19288344 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1005783558 6:29218704-29218726 CTTTATTAGCAGCATGAGAATGG + Intergenic
1005864227 6:29926480-29926502 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1005905532 6:30259647-30259669 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1006217226 6:32454621-32454643 CTTTATTAGCAGCATGATAATGG + Intergenic
1006288791 6:33117870-33117892 CCACTTTCTCAGCATGAGGAAGG - Intergenic
1006721553 6:36156341-36156363 CTTTATTAGCAGCATAAGAACGG - Intergenic
1007283440 6:40729893-40729915 TCTCCTAAGCAGCATGAGCAGGG + Intergenic
1007810561 6:44482836-44482858 CCTCTTCAGCAGCGGGAGGAAGG + Intergenic
1008658871 6:53644775-53644797 CTTTATTAGCAGCATGAGAATGG + Intergenic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1008903059 6:56645139-56645161 CTTTATTAGCAGCGTGAGAATGG + Intronic
1008966996 6:57322698-57322720 CTTTATTAGCAGCATGAGAATGG + Intronic
1008974274 6:57406242-57406264 CCTCATTATCAGCAAGGGTATGG - Intronic
1009345995 6:62613460-62613482 CTTCATCAGCAGCATGAAAATGG + Intergenic
1009377661 6:62991759-62991781 CTTTATTAGCAGCATGAGAATGG - Intergenic
1009447799 6:63763777-63763799 CTTTATTAGCAGCCTGAGAACGG + Intronic
1009468633 6:64004016-64004038 CCTTTATAGCAGCATGAGAATGG + Intronic
1009482977 6:64183283-64183305 CTTTATTAGCAGCATGAGAATGG + Intronic
1009501400 6:64419153-64419175 CTTTATTAGCAGCACGAGAATGG - Intronic
1009503298 6:64443869-64443891 CCTCATCAGCAGCATGAAAATGG + Intronic
1009569643 6:65367920-65367942 CTTTATTAGCAGTATGAGAATGG - Intronic
1009620187 6:66064858-66064880 CTTTATTAGCAGCATGAGAATGG + Intergenic
1010003688 6:70972904-70972926 CTTTATCAGCAGCATGAGAATGG + Intergenic
1010027228 6:71233226-71233248 CTTTATTAGTAGCATGAGAATGG + Intergenic
1010061137 6:71624582-71624604 CTTCATTAGCAGCATGAGAAAGG + Intergenic
1010578319 6:77561877-77561899 CCTAATCAGCAGCATGAAAACGG - Intergenic
1010709900 6:79161729-79161751 ATTTATTAGCAGCATGAGAACGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011026188 6:82872008-82872030 CCTTATTAGCAGCATGAGAACGG + Intergenic
1011040973 6:83030563-83030585 CTTTATTAGCAGCATGAGAACGG + Intronic
1011129644 6:84040342-84040364 CTTTATTGGCAGCATGAGAATGG + Intronic
1011129925 6:84042317-84042339 CTTTATTAGCAGTATGAGAATGG + Intronic
1011263891 6:85496249-85496271 CTTTATTAGCAGCATGAGAACGG - Intergenic
1011834133 6:91408931-91408953 CATCATTAGCAGCATGAAAATGG + Intergenic
1012005908 6:93712633-93712655 CTTTATTAGCAGCATGAGAATGG + Intergenic
1012250994 6:96980821-96980843 CTTTATTAGCAGCATGAGAACGG - Intronic
1012390184 6:98729378-98729400 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1012391135 6:98741319-98741341 CTTTATGAGCAGCATGAGAATGG + Intergenic
1012867272 6:104633349-104633371 CTTTATTAGCAGTATGAGAAGGG - Intergenic
1013338560 6:109190828-109190850 CTTTATTAGCAGCACGAGAATGG + Intergenic
1013417159 6:109935353-109935375 CTTTATTAGCAGCATGAGAATGG - Intergenic
1013823499 6:114183481-114183503 CTTTATTAGCAGCATGAAAATGG + Intronic
1013825055 6:114201663-114201685 CTTTATTAGCAGCCTGAGAACGG - Intronic
1014062091 6:117083224-117083246 CTTTATTGGCAGCATGAGAATGG + Intergenic
1014101461 6:117516639-117516661 CCTTATCAGCAGCATGAAAATGG - Intronic
1014101740 6:117518523-117518545 CCTTATCAGCAGCATGAAAACGG - Intronic
1014133606 6:117863273-117863295 CTTGATTAGCAGTATGAGAATGG + Intergenic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014154372 6:118093699-118093721 CTTTATTAGCAGCATAAGAATGG + Intronic
1014237008 6:118969279-118969301 CTTTATTAGCAGCGTGAGAACGG + Intronic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014444644 6:121513146-121513168 CTTCATTAGAAGCGTGAGAACGG + Intergenic
1014475794 6:121871311-121871333 CCTTATTTGCAGCATGAGAACGG - Intergenic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014580976 6:123137017-123137039 CTTTATTAGCAGCATGAGAATGG + Intergenic
1014582636 6:123157798-123157820 CTTTATTAGCAGCATGAAAATGG + Intergenic
1014723747 6:124950796-124950818 CTTTATTAGCAGCATAAGAATGG + Intergenic
1014742312 6:125160148-125160170 CTTTATTAGCAGCATAAGAATGG + Intronic
1014841676 6:126227104-126227126 CTTTATTAGCAGCATGAAAATGG + Intergenic
1014860529 6:126461359-126461381 CCTTATTAGCAGCATGCAAATGG + Intergenic
1014882781 6:126743909-126743931 CTTTATTAGCAGTATGAGAATGG + Intergenic
1015053686 6:128874413-128874435 CTTTATTAGCAGCATGAAAATGG + Intergenic
1015061853 6:128975865-128975887 CTTTATTAGCAGCATGAGAATGG + Intronic
1015067286 6:129046269-129046291 CTTTATTAGTAGCATGAGAATGG - Intronic
1015199285 6:130561210-130561232 CTTTATTAGCAGCATGAGAATGG - Intergenic
1015216999 6:130761869-130761891 CTTTTTTAGCAGCATGAGAACGG - Intergenic
1015481076 6:133710672-133710694 CTTTATTAGCAGCATGAAAATGG - Intergenic
1015598259 6:134887259-134887281 CTTTATTAGCAGCATGAGAACGG - Intergenic
1015633738 6:135255709-135255731 CTTTATTGGCAGCATGAGAATGG + Intergenic
1015995651 6:138993290-138993312 CTTTATTAGCAGCATGAGAACGG + Intergenic
1015995930 6:138995242-138995264 CTTTATTAGCAGCATGAGAATGG + Intergenic
1016085313 6:139906415-139906437 CTTTATTAGCGGCATGAGAATGG - Intergenic
1016106701 6:140172150-140172172 CTTCATCAGCAACATGAAGATGG - Intergenic
1016142350 6:140627846-140627868 CATTATTAGCAGCATGAGAATGG - Intergenic
1016168555 6:140978676-140978698 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1016241768 6:141939712-141939734 CTTTATTAGCAGCATGAAAATGG + Intergenic
1016346603 6:143120352-143120374 CTTTATTAGCAGCGTGAGAATGG - Intronic
1016355150 6:143210307-143210329 CTTTATTAGCAGCATGAGAATGG + Intronic
1016410008 6:143772924-143772946 CCTCATTAGCATTAAGAGGCTGG + Intronic
1016524163 6:144981589-144981611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1016564691 6:145440083-145440105 CTTCATTAGCAGCATGAAAACGG - Intergenic
1016598503 6:145828508-145828530 CTTTATTAGGAGCATGAGAATGG + Intergenic
1016623012 6:146134400-146134422 CTTTACTAGCAGCATGAGAACGG - Intronic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1016737482 6:147494988-147495010 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1016856870 6:148679364-148679386 CTTTATTAGCAGCATGATAATGG + Intergenic
1017306281 6:152922199-152922221 CCTTATCAGCAGCATGAAAACGG + Intergenic
1017531980 6:155302772-155302794 CTTTATTAGCAGCATGAGAACGG - Intronic
1017580621 6:155860347-155860369 CTTTATTAGCAGCATGAAAATGG + Intergenic
1017690358 6:156957795-156957817 CCTCATTTGCTGGATGAGTAGGG + Intronic
1017790558 6:157794381-157794403 CTTTATTAGCAGCATGAAAACGG + Intronic
1017804465 6:157931816-157931838 CCTAATCCTCAGCATGAGGATGG + Intronic
1017984080 6:159427213-159427235 CTTTATTAGCAGCCTGAGAACGG + Intergenic
1018093760 6:160367084-160367106 CTTTATTAGCAGCATAAGAATGG - Intronic
1018245009 6:161814368-161814390 CTTTATTAGCAACATGAGAATGG - Intronic
1018421902 6:163647399-163647421 CCGCCTTGGCAGCATTAGGAAGG + Intergenic
1018454942 6:163943578-163943600 CCTCATGAGCTGCTTGAAGAGGG + Intergenic
1018585349 6:165350968-165350990 CTTTATTAGCAGCATGAGAACGG + Intronic
1019150704 6:170003754-170003776 CTTTATTAGCAGCATGAGAATGG - Intergenic
1019684652 7:2374428-2374450 CCTCATGGGCAGCATGAGCACGG + Intronic
1019878343 7:3836108-3836130 CCTCATTAGTCTCATGAGCAGGG + Intronic
1020535252 7:9388874-9388896 CCTTCATAGCAGCATGAGAATGG + Intergenic
1020546807 7:9542552-9542574 TCTTATTAGCAGCCTGAGAATGG + Intergenic
1020701319 7:11487542-11487564 CTTGATTAGCAGCATGAAAATGG - Intronic
1020750268 7:12132280-12132302 CCTTTATAGCAGCATGAGAATGG - Intergenic
1020928800 7:14367567-14367589 CTTTATTAGCAGTATGAGAATGG + Intronic
1021063818 7:16147237-16147259 CTTTATTAGCAACATGAGGATGG + Intronic
1021138666 7:16996317-16996339 CTTTATTAGCAGCATGAGAATGG - Intergenic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1021840240 7:24716539-24716561 TCTCATTGGGAACATGAGGAGGG + Intronic
1021904485 7:25319742-25319764 CCTCATCATCATCAAGAGGAGGG - Intergenic
1022038744 7:26559231-26559253 CTTTATTAGCAGCATGAGAATGG - Intergenic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1022417156 7:30188343-30188365 CTTTATTGGCAGCATGAGAAAGG - Intergenic
1022480033 7:30736973-30736995 CTTTATTAGCAGCGTGAGAATGG + Intronic
1022481955 7:30750082-30750104 CCTTATTAGCAGTATGAAAACGG - Intronic
1022590779 7:31660207-31660229 CTTTATTAGCAGCCTGAGAACGG + Intergenic
1022595812 7:31712652-31712674 CTTCATTAGCAGCATGAAAAGGG - Intergenic
1022863097 7:34388359-34388381 CTTTATTAGCAGCATGAGAATGG + Intergenic
1022976157 7:35558606-35558628 TCTTATTAGCAGCATGAGAATGG + Intergenic
1023162284 7:37309076-37309098 CTTTATTAGCAGCATGAGAACGG - Intronic
1023274179 7:38500046-38500068 CTTTATTAGCAGCGTGAGAACGG + Intronic
1023376580 7:39562196-39562218 CCTCTGTGGCAGCATGAGAATGG - Intergenic
1023685595 7:42731540-42731562 CTTTATTAGCAGCATGAGAATGG + Intergenic
1024114631 7:46181058-46181080 CTTTATTAGCAGCATGAGAATGG - Intergenic
1024180991 7:46894709-46894731 CTTCATCAGCAGCATGAAAACGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024254987 7:47533938-47533960 CTTCATCAGCAGCATGAAAATGG + Intronic
1024843803 7:53618989-53619011 CCCTATTAGCAGCATGAGAATGG + Intergenic
1025273252 7:57546365-57546387 CCTCAGCAGCCACATGAGGAGGG - Intergenic
1026051467 7:66950576-66950598 CTTTATCAGCAGCATGAGAAAGG + Intronic
1026109433 7:67447110-67447132 CTTTATTAGCAGCATGAGAATGG + Intergenic
1026225653 7:68437768-68437790 CTTTATTAGCAGCATGAAAACGG + Intergenic
1026232558 7:68497930-68497952 CTTTATTAGCAGCATGAGAATGG + Intergenic
1026532232 7:71209713-71209735 CCTTATCAGCAGCATGAAAACGG - Intronic
1026621664 7:71955007-71955029 CTTTATTAGCAGTATGAGAAGGG - Intronic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1027156528 7:75772170-75772192 CCTGATTTGCAGCATCATGATGG - Exonic
1027551009 7:79595009-79595031 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1027558898 7:79702428-79702450 CTTCATTAGCAGTGTGAGAATGG - Intergenic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1027834323 7:83220328-83220350 CTTTATTAGCAGCATGAAAATGG + Intergenic
1027842957 7:83337799-83337821 CTTTATTAACAGCATGAGAAGGG - Intergenic
1028041826 7:86062979-86063001 CTTTATTAGCAGCATGAAAACGG + Intergenic
1028070526 7:86444316-86444338 CTTTATTAGCAGCATGAAAATGG + Intergenic
1028292022 7:89076523-89076545 CTTCATCAGCAGCATGAAAATGG + Intronic
1028326178 7:89527908-89527930 CTTTATTAGCAGCATGAAAATGG - Intergenic
1028401409 7:90429565-90429587 CTTTATTAGTAGCATGAGAAGGG + Intronic
1028679302 7:93507094-93507116 CTTCATTAGCAGTGTGAGAATGG + Intronic
1028715224 7:93957694-93957716 CCTTATTAGCAGCATGAGAACGG + Intergenic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1028840416 7:95423718-95423740 CTTTATTAGCAGCCTGAGAACGG - Intronic
1028884286 7:95913672-95913694 CTTTATTAACAGCATGAGAAAGG + Intronic
1029340033 7:99935081-99935103 CTTCATTAGCAGCGTGAAAATGG - Intergenic
1029736553 7:102468702-102468724 CCTGAACAGCAGCATGGGGATGG + Intronic
1029865202 7:103620326-103620348 CTTCATCAGCAGCGTGAGAATGG + Intronic
1029900217 7:104031102-104031124 CTTTCTTAGCAGCATGAGAATGG + Intergenic
1030512492 7:110500990-110501012 CCACATTAACAGAATGAAGAGGG - Intergenic
1030527768 7:110674028-110674050 CTTTATTAGCAGCATGAGAATGG - Intronic
1030563399 7:111120212-111120234 CTCTATTAGCAGCATGAGAACGG - Intronic
1030729728 7:112972187-112972209 CTTTATTAGCAGCTTGAGAACGG + Intergenic
1030870294 7:114747422-114747444 CCTCATTAGCACCGAGAGAATGG + Intergenic
1031074042 7:117195459-117195481 CTTTATTTGCAGCATGAGAATGG - Intronic
1031194092 7:118590429-118590451 CTTTATTAACAGCATGAGAACGG + Intergenic
1031413807 7:121472068-121472090 CTTTATTAGCAGCATGAGAACGG - Intergenic
1031521963 7:122777852-122777874 CTTTATTAGCAGCATGAGAATGG + Intronic
1031608122 7:123793768-123793790 CTTTATTAGCAACATGAGAATGG + Intergenic
1031616994 7:123893529-123893551 CTTTATTAGTAGCATGAGAATGG + Intergenic
1031778349 7:125930758-125930780 CTTTATCAGCAGCATGAGAAAGG - Intergenic
1031778909 7:125938565-125938587 CTTCATTAGCAGCATGAGAATGG + Intergenic
1031793446 7:126139797-126139819 CTTTATTAGCAGGATGAGAATGG - Intergenic
1032106136 7:129032081-129032103 CCACATTAACAGAATGAAGAAGG + Intronic
1032179334 7:129661864-129661886 CCTTATCAGCAGCATGAAAATGG - Intronic
1032440495 7:131939131-131939153 CTTTATTAGCAGCATGAGAATGG + Intergenic
1032665505 7:134032411-134032433 TCCCATTAGCAGCAGGAAGATGG - Intronic
1032703973 7:134406183-134406205 CTTTATCAGCAGCATGAGAATGG + Intergenic
1032865168 7:135917563-135917585 CTTTATTAGCAGCATGAGAACGG + Intergenic
1032995274 7:137439298-137439320 CTTTATTAGCAACATGAGAATGG - Intronic
1033048407 7:137982727-137982749 CTTTATCAGCAGCATGAGAACGG + Intronic
1033057932 7:138077170-138077192 CTTTAATAGCAGCATGAGAATGG - Intronic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1033772452 7:144567460-144567482 CTTCATCAGCAGCATGAAAATGG - Intronic
1034013011 7:147550545-147550567 CTTTATTAGCAGCATGAGAATGG + Intronic
1034029231 7:147741873-147741895 CTTTATCAGCAGCATGAGAATGG - Intronic
1034037173 7:147837114-147837136 CTTTATTAGCAGCATGAAAATGG - Intronic
1034040577 7:147873295-147873317 CCTTATTAGCAGAATGAGAATGG - Intronic
1034742752 7:153494012-153494034 CCTTATTAGCAGTATGAGAATGG + Intergenic
1035116533 7:156529289-156529311 CTTTATTAGCAGCATGAGAATGG - Intergenic
1035371160 7:158379771-158379793 CTTTATTAGCAGCATGAAAAAGG - Intronic
1035796773 8:2364715-2364737 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036123228 8:6040032-6040054 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1036771470 8:11581307-11581329 CTTTATTAGCAGCTTGAGAACGG - Intergenic
1037097517 8:15003358-15003380 CTTTATTAGCAGCATTAGAATGG + Intronic
1037151706 8:15643271-15643293 CTTTATTAGCAGCATGAGAATGG + Intronic
1037178527 8:15975059-15975081 CTTTATCAGCAGCATGAGAACGG + Intergenic
1037243568 8:16805238-16805260 CCTTATCAGCAGCATGAAAATGG - Intergenic
1037311249 8:17559225-17559247 CTTTATTAGCAGCACGAGAATGG - Intronic
1037363822 8:18102040-18102062 CTTTATTAGCAGCATGAAAATGG - Intergenic
1037367160 8:18135277-18135299 CTTTATTTGCAGCATGAGAACGG + Intergenic
1037452418 8:19029379-19029401 CTTTATTAGCAGCATGAGAATGG - Intronic
1037532923 8:19795589-19795611 CTTTATTAGCAGCATGAAAATGG + Intergenic
1037626296 8:20610155-20610177 CTTTCTTAGCAGCATGAGAATGG - Intergenic
1037993613 8:23337939-23337961 CTTTATTAGCAGCATGAGAATGG - Intronic
1038150359 8:24937840-24937862 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038159293 8:25021473-25021495 CTTCATTAGCAGCATGAGAAAGG + Intergenic
1038159389 8:25022493-25022515 CTTTATTAACAGCATGAGAATGG - Intergenic
1038194861 8:25358107-25358129 CTTTATTAGCAGCATGAGAACGG - Intronic
1038393555 8:27229279-27229301 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038899524 8:31826575-31826597 CTTAATTAGCAGCATGAGAATGG + Intronic
1038913490 8:31993693-31993715 CTTTATCAGCAGCATGAGAATGG + Intronic
1039029412 8:33293506-33293528 CTTTATCAGCAGCATGAGAATGG - Intergenic
1039071530 8:33653175-33653197 CTTTATTAGCAGCATGAGAGTGG + Intergenic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1039418408 8:37415803-37415825 CTTTATTAGCAGCTTGAGAATGG - Intergenic
1040384978 8:46908871-46908893 CTTTATTAGCAGTATGAGAAAGG + Intergenic
1040540093 8:48346144-48346166 GTTCATTAGCAGCATGAGAATGG + Intergenic
1040972605 8:53153216-53153238 CTTCAGTAGCAGCATGAGTATGG + Intergenic
1041333846 8:56757871-56757893 CTTTATTAGCAGCATGAGAATGG - Intergenic
1041654509 8:60335674-60335696 CCTTATTAGCAGTGTGAGAATGG + Intergenic
1041654632 8:60336494-60336516 CTTCATTAGCAGCGTGAGAATGG + Intergenic
1042298037 8:67243249-67243271 CTTTATTAGCAGCTTGAGAATGG - Intronic
1042684447 8:71422557-71422579 CTTTATTAGCAGCATGAGAATGG - Intronic
1042700868 8:71612665-71612687 CTTTATTAGCACCATGAGAATGG + Intergenic
1042776031 8:72432408-72432430 CTCTATTAGCAGCATGAGAATGG - Intergenic
1043093104 8:75929322-75929344 CTTTATTAGCAGCATGAAAATGG - Intergenic
1043266135 8:78269849-78269871 CTTTATTAACAGCATGAGAATGG - Intergenic
1043336550 8:79182961-79182983 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1043345993 8:79297854-79297876 CTTTATTAGCAGCATGGGAATGG + Intergenic
1043595295 8:81878460-81878482 CTTTATTAACAGCATGAGAATGG + Intergenic
1043794786 8:84522870-84522892 CTTTATTAGCAGCATGAGAATGG - Intronic
1043794814 8:84523102-84523124 CTTTATTAGCAGCACGAGAATGG - Intronic
1043940289 8:86189158-86189180 TCTTCTTAGCAGCATGAGAATGG - Intergenic
1043973961 8:86564345-86564367 CTTTACTAGCAGCATGAGAACGG - Intronic
1044193901 8:89352324-89352346 CTTTATTAGCAGCATGAAAATGG - Intergenic
1044234119 8:89810162-89810184 CTTTATTAGCAGCATGAGAATGG + Intergenic
1044324665 8:90846599-90846621 CTTTATTAGCAGCATGAGAATGG - Intronic
1044439052 8:92201509-92201531 CTTTATTAGCAGCATGAAAACGG - Intergenic
1045139997 8:99269156-99269178 TCTTTATAGCAGCATGAGGATGG + Intronic
1045207587 8:100057761-100057783 CTTTATTAGTAGCATGAGAATGG + Intronic
1045545641 8:103125852-103125874 CCTTATTAGTAGCATGAGAACGG - Intergenic
1045646856 8:104307849-104307871 CTTCATTAGCAGCATGAGAATGG - Intergenic
1045735853 8:105295948-105295970 CTTTATTAGCAGCATGAAAATGG - Intronic
1045894737 8:107201801-107201823 CTTTATTAGCAACATGAGAATGG - Intergenic
1045939909 8:107727447-107727469 CTTTATTAGCAGCATGAAAATGG - Intergenic
1046258229 8:111729157-111729179 CTTCAGTAGCAGCAAGAGGCAGG - Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046442089 8:114270566-114270588 CCTTTATAGCAGCATGAGAATGG - Intergenic
1046452105 8:114406591-114406613 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046477970 8:114773872-114773894 CTTTATTAGCAGCATGAAAATGG - Intergenic
1046506860 8:115147588-115147610 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046600687 8:116314242-116314264 CTTTATCAGCAGCATGAGAATGG - Intergenic
1046613565 8:116451571-116451593 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1046835419 8:118795562-118795584 CTTTATTAGCATCATGAGAATGG + Intergenic
1046940337 8:119924924-119924946 CTTTATTAGCAGCATGAGAATGG - Intronic
1047206712 8:122808259-122808281 CTTTATTAGCAGCATGAGAATGG - Intronic
1047303566 8:123635490-123635512 CCGCACTATCTGCATGAGGAAGG - Intergenic
1047346918 8:124037796-124037818 CCTGATTGGCAGGGTGAGGAGGG - Intronic
1047427595 8:124760751-124760773 CTTCATTAGTTGCATGAGAATGG - Intergenic
1047482544 8:125298529-125298551 CCTCATTAGCAGGATAATGCGGG + Intronic
1047487858 8:125348830-125348852 CTTTATTAGCAGCACGAGAACGG + Intronic
1047827892 8:128597686-128597708 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1048078286 8:131097262-131097284 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1048591698 8:135826521-135826543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1048622887 8:136153877-136153899 CTTTATTAGCAGCATGAGAATGG + Intergenic
1048669223 8:136697138-136697160 CTTTATTAGCAGCATGAGAATGG + Intergenic
1048801514 8:138198356-138198378 CTTTATTAGCAGCCTGAGAATGG + Intronic
1048901083 8:139038316-139038338 TCTTATTAGCAGCCTGAGAATGG - Intergenic
1049345652 8:142137220-142137242 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1050013413 9:1208441-1208463 CCTCTGTAGCAAGATGAGGAAGG + Intergenic
1050214257 9:3304813-3304835 CTTTATCAGCAGCATGAGAACGG + Intronic
1050644493 9:7704161-7704183 CTTCATCAGCAGCATGAAAATGG - Intergenic
1050720599 9:8584730-8584752 CTCCATTTGCAGCATGAGAATGG - Intronic
1051017138 9:12491987-12492009 CTTTATTAGCAGCATGAGAATGG + Intergenic
1051263809 9:15291511-15291533 CTTTATCAGCAGCATGAGAACGG + Intronic
1051272479 9:15368700-15368722 CTTTATTAGCAGCATGAGAATGG + Intergenic
1051986498 9:23095805-23095827 CTTTATTAGCATCATGAGAATGG + Intergenic
1052124149 9:24755107-24755129 CTTTATTAGCAGCATGAGAACGG + Intergenic
1052217911 9:25989328-25989350 CTTTATTAGCAGCATGAAAATGG - Intergenic
1052311418 9:27073128-27073150 CTTTATTAGCAGCATGAAAATGG + Intergenic
1052414345 9:28158090-28158112 CTTTATTAGCAGCATGAAAATGG - Intronic
1052526761 9:29628765-29628787 CTTCATTAGTATCATGAGAACGG + Intergenic
1052640836 9:31164672-31164694 TCTCATCAGCATCATAAGGAGGG - Intergenic
1052689871 9:31803048-31803070 CTTTATTAGCGGCATGAGAATGG + Intergenic
1053483895 9:38437552-38437574 CTACATTTGCAGCATGAGAAGGG + Intergenic
1053615068 9:39757109-39757131 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1053721093 9:40947267-40947289 CTTTATTAGCAGCATGAGAATGG - Intergenic
1053873238 9:42516369-42516391 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1053899516 9:42779547-42779569 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1054238452 9:62585282-62585304 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1054262141 9:62878037-62878059 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1054269090 9:62950383-62950405 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1054344896 9:63904888-63904910 CTTTATTAGCAGCATGAGAATGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054552581 9:66619802-66619824 CTTTATTAGCAGCGTGAGAACGG + Intergenic
1054868443 9:70026463-70026485 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055001876 9:71460381-71460403 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055170641 9:73254092-73254114 CTTTATTAATAGCATGAGGATGG + Intergenic
1055179549 9:73367554-73367576 CTTTATTAGCAACATGAGAACGG - Intergenic
1055484403 9:76743236-76743258 TCTCTATAGCAGCATGAGAATGG + Intronic
1055489738 9:76792404-76792426 CCTTATTAGCAGCGTGAGAATGG + Intronic
1055534733 9:77228704-77228726 CTTCATTAACAGCATGAAAATGG - Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055595446 9:77861000-77861022 CTTCATCAGCAGCATGAAAATGG - Intronic
1055764237 9:79644368-79644390 CTATATTAGCAGCATGAGAACGG + Intronic
1055832117 9:80392388-80392410 CTTTATTAGCAGCCTGAGAATGG - Intergenic
1056064310 9:82917270-82917292 CTTTATTAGCAGCATGAGAACGG - Intergenic
1056086559 9:83155282-83155304 CTTCATCAGCAGCATGAAAATGG - Intergenic
1056784320 9:89579204-89579226 CCTTATTAGCAGAATGAGAATGG - Intergenic
1057927461 9:99166006-99166028 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1058320306 9:103621998-103622020 CTTTACTAGCAGCATGAGAATGG - Intergenic
1058464899 9:105217409-105217431 CTTTATTAGCAGTATGAGAATGG - Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1058725269 9:107797322-107797344 CTTTATCAGCAGCATGAGAACGG - Intergenic
1058730236 9:107842836-107842858 CTTCATTAGCAGCGTGAGAACGG + Intergenic
1058779550 9:108319159-108319181 CCTTATTAGCAGTGTGAGGATGG + Intergenic
1058892844 9:109375493-109375515 CTTTATTAGCAGCATGAGAATGG + Intronic
1058906592 9:109487038-109487060 CTTTATTAGCAGCGTGAGAATGG + Intronic
1058998203 9:110320517-110320539 CTTTATTAGCAGCATGAGAACGG + Intronic
1059040811 9:110813803-110813825 CTTTATTAGCAGCATGAGAATGG - Intergenic
1059263520 9:113003409-113003431 TTTTATTAGCAGCATGAGAATGG + Intergenic
1059490746 9:114665574-114665596 CTTTATTAACAGCATGAGAACGG - Intergenic
1059628455 9:116092720-116092742 CTTTATTAGCAGTATGAGAATGG + Intergenic
1059666993 9:116456482-116456504 CCTTATCAGCAGCATGAAAATGG - Intronic
1059801465 9:117753527-117753549 CTTTATTAGCAGCATAAGAAAGG - Intergenic
1059875625 9:118631497-118631519 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060308786 9:122440536-122440558 TTTTATTAGCAGCATGAGAATGG - Intergenic
1060730197 9:126032190-126032212 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060751954 9:126175972-126175994 CTTTATTAGCAGCATGAGAATGG - Intergenic
1060761155 9:126249933-126249955 CTTTATTAGCAGCATGAAAATGG - Intergenic
1061332728 9:129906668-129906690 CTTTATTAGCAGCATGAGAATGG + Intronic
1061656199 9:132092205-132092227 CTTTATTAGTAGCATGAGAACGG + Intergenic
1062214459 9:135381612-135381634 CTCTATTAGCAGCATGAGAACGG + Intergenic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1203428646 Un_GL000195v1:67012-67034 CCTTATTATCAGCATGATAATGG + Intergenic
1203454094 Un_GL000219v1:148883-148905 CTTTATTAGCAGCATGAGAATGG + Intergenic
1203624933 Un_KI270750v1:6991-7013 CCTCAGCAGCCACATGAGGAGGG - Intergenic
1185674333 X:1836700-1836722 CTTTATTAGTAGCATGAGAACGG - Intergenic
1185845036 X:3430008-3430030 CTTTATTAGCAGCATGAGAACGG + Intergenic
1185872669 X:3677022-3677044 CTTCATTAACAGCATGAGAATGG + Intronic
1186036205 X:5426147-5426169 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186042159 X:5492494-5492516 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186062000 X:5719131-5719153 CTTTATTAGTAGCATGAGAACGG - Intergenic
1186109367 X:6239678-6239700 GTTTATTAGCAGCATGAGAATGG - Intergenic
1186156043 X:6727978-6728000 CTTTATTAGCAGCATGAAAATGG - Intergenic
1186167306 X:6840327-6840349 CTTTATCAGCAGCATGAGAATGG + Intergenic
1186221732 X:7356325-7356347 CTTTATTAGCAGCATGACAACGG - Intergenic
1186258090 X:7744517-7744539 CTTAATTAGCAGCATGAAAATGG + Intergenic
1186537550 X:10365411-10365433 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186570185 X:10706696-10706718 CTTTATTAGCAGCATAAGAATGG + Intronic
1186988347 X:15040518-15040540 CTTTATTAGCAGCATGGGAACGG - Intergenic
1187030313 X:15480322-15480344 CCTTATCAGCAGCATGAAAATGG + Intronic
1187260893 X:17684226-17684248 CTTTATTAGCAGCATGAGAATGG + Intronic
1187277591 X:17829433-17829455 CCCCATTAGATGCATGAGGTTGG - Intronic
1187948953 X:24453179-24453201 CTTTATTAGCAGCATGAAAATGG + Intergenic
1188010979 X:25055637-25055659 CTTTATTAGCAGCATGAAAATGG - Intergenic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1188155776 X:26740792-26740814 CTTCATTAGCAGCATGAGGATGG - Intergenic
1188457318 X:30380934-30380956 CTTTATTAGCAGCATGAGACTGG + Intergenic
1188606613 X:32039268-32039290 CCTCATGAGAAGGATGAGAAAGG + Intronic
1188749413 X:33886273-33886295 CTTTATTAGCAGTATGAGAATGG + Intergenic
1188907780 X:35808892-35808914 CTTTATTAGCAGCATGAAAACGG + Intergenic
1188973563 X:36646590-36646612 CTTTATTAGCAGCATGGGAATGG + Intergenic
1189202842 X:39212495-39212517 CTTTATTAGCAGCATGAGAACGG + Intergenic
1189257319 X:39650656-39650678 CTTTAATAGCAGCATGAGAATGG + Intergenic
1189433207 X:40968071-40968093 CTTTATTAGCAGCATGAGAATGG - Intergenic
1191593487 X:62915518-62915540 CTTTATTAGCAGCATGAGAATGG + Intergenic
1191891232 X:65944147-65944169 CTTTATTAGCAGCATGATAATGG - Intergenic
1191931672 X:66380173-66380195 CTTTATTAGCAGCATGAGAATGG - Intergenic
1192334851 X:70209938-70209960 CTTTATTAGCAGCATGAGAACGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1192508335 X:71704958-71704980 CTTTATTAGCAGCAAGAGAACGG + Intergenic
1192518361 X:71776595-71776617 CTTTATTAGCAGCAAGAGAACGG - Intergenic
1192527056 X:71856075-71856097 CTTTATTAGCAGCAAGAGAATGG + Intergenic
1192722762 X:73717094-73717116 CTTTATTAGCAGCATGAAAATGG - Intergenic
1192742323 X:73905250-73905272 CTTTATTAGCAGCATGAAAATGG + Intergenic
1193003967 X:76595647-76595669 CTTTATTAGCAGCATGAAAACGG - Intergenic
1193008253 X:76644886-76644908 TCTTATTAGCAGCATGAGAATGG + Intergenic
1193025035 X:76837927-76837949 CTTTATTAGCAGCATCAGAATGG - Intergenic
1193211018 X:78806936-78806958 CTTTATTAGCATCATGAGAATGG + Intergenic
1193278176 X:79615753-79615775 CTTTATTAGCAGCATAAGAACGG + Intergenic
1193331368 X:80238744-80238766 CTTTATTAGCAGCATGAAAATGG - Intergenic
1193388077 X:80894323-80894345 CTTTATTAGAAGCATGAGTATGG + Intergenic
1193467420 X:81866565-81866587 CTTTATTAGCACCATGAGAATGG - Intergenic
1193644699 X:84053258-84053280 CCTTATCAGCAGCATGAAAATGG + Intergenic
1193969857 X:88038075-88038097 CTTTATTAGCAGCATGAAAATGG + Intergenic
1194106841 X:89780137-89780159 CTTTATTAGCAGTATGAGAATGG - Intergenic
1194145743 X:90260237-90260259 CTTTATTAACAGCATGAGAACGG - Intergenic
1194339924 X:92695012-92695034 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194455970 X:94104203-94104225 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194659844 X:96618639-96618661 CTTTATTAGCAGCATGAGAATGG - Intergenic
1194756468 X:97744451-97744473 CTTTATTAGCAGCATGAGAATGG + Intergenic
1194825390 X:98556293-98556315 CTTTATTAGAAGCATGAGGATGG - Intergenic
1194952539 X:100144374-100144396 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195536198 X:106011975-106011997 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195819492 X:108929382-108929404 CTTTATTAGCAACATGAGAATGG - Intergenic
1195864010 X:109409904-109409926 CTTTATTAGCAGCATGATAACGG + Intronic
1196554840 X:117074307-117074329 CTTTATTAGCAGCATGAGAGTGG - Intergenic
1196579284 X:117360669-117360691 CTTTATTAGCAGCATGAAAACGG + Intergenic
1196625552 X:117873300-117873322 CTTTATTAGTAGCATGAGAATGG - Intergenic
1196760646 X:119197913-119197935 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197025870 X:121749055-121749077 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197349903 X:125370697-125370719 GTTGATTAGCAGCATGAGAATGG - Intergenic
1197471820 X:126872825-126872847 CCTTTTTAGCAGCATGAGAATGG - Intergenic
1197507611 X:127327334-127327356 CTTTATTAGCAGCATGAGAATGG - Intergenic
1197566886 X:128099301-128099323 CTTTATTAGCAGCATGAAAATGG - Intergenic
1197798525 X:130324085-130324107 CATTATTAGCAGCATGAGAGAGG - Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198024137 X:132688385-132688407 CTTTATTAGCAGCATGAGAATGG - Intronic
1198080950 X:133238995-133239017 CCCAGTTAGCAGCATGAGAATGG - Intergenic
1198085392 X:133277588-133277610 CTTTATTAGCAGCATGAAAATGG + Intergenic
1198201276 X:134421361-134421383 TCTCATTAGTTGCATAAGGATGG + Intronic
1198250339 X:134874028-134874050 CTTTATTAGCAGCGTGAGAATGG - Intergenic
1198452990 X:136786481-136786503 CTTTATTAGCAGCATGAGAATGG - Intergenic
1198847147 X:140924490-140924512 CTTTATTAGCAGCGTGAGAACGG - Intergenic
1198858174 X:141041004-141041026 CCTTTATAGCAGCATGAGAATGG - Intergenic
1198904521 X:141546366-141546388 CCTTTATAGCAGCATGAGAATGG + Intergenic
1198919183 X:141707096-141707118 CTTTATTAGCAGCATGAGAACGG - Intergenic
1198919201 X:141707281-141707303 CTTTATCAGCAGCATGAAGATGG - Intergenic
1199044143 X:143148642-143148664 CTTTATTACCAGCATGAGAATGG + Intergenic
1199192210 X:144982936-144982958 CTTTATTAGCAGCGTGAGAATGG + Intergenic
1199203961 X:145125378-145125400 CTTTATTAGCAGTATGAGAATGG - Intergenic
1199346338 X:146745851-146745873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1199351560 X:146808463-146808485 CTTCATGAGCAGCATGAAAATGG + Intergenic
1199352347 X:146816030-146816052 CTTCATGAGCAGCATGAAAATGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199621487 X:149705517-149705539 CCTTATCAGCAGCATGAAAATGG + Intronic
1199751409 X:150823179-150823201 CTTTATTAGCAGCATGAGAATGG + Intronic
1199909271 X:152268545-152268567 CTTTATTAGCAGCATAAGAATGG + Intronic
1200417468 Y:2927212-2927234 CTTTATTAGCAACATGAGAATGG + Intronic
1200458803 Y:3428002-3428024 CTTTATTAGCAGTATGAGAATGG - Intergenic
1200491494 Y:3829532-3829554 CTTTATTAACAGCATGAGAACGG - Intergenic
1200648310 Y:5811795-5811817 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1200791261 Y:7301638-7301660 CTTTATTAGCAGCATGAGAATGG - Intergenic
1201509029 Y:14736884-14736906 CTTTATTAGCAACATGAGAATGG + Intronic
1201546141 Y:15164208-15164230 CTTTATTAGTAGCATGAGAAAGG - Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic
1201959226 Y:19660396-19660418 CTTTATTAGCAGCATGAAAACGG - Intergenic
1202019752 Y:20452073-20452095 CCTTATTAGCAGCATGAAAATGG + Intergenic