ID: 1078947408

View in Genome Browser
Species Human (GRCh38)
Location 11:16085143-16085165
Sequence ACCCCTATTTGGCCATGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078947404_1078947408 -3 Left 1078947404 11:16085123-16085145 CCTCTTGGGCCCTGGAACAAACC 0: 1
1: 0
2: 4
3: 12
4: 200
Right 1078947408 11:16085143-16085165 ACCCCTATTTGGCCATGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 90
1078947400_1078947408 30 Left 1078947400 11:16085090-16085112 CCAATGACATAACTACACATTAT 0: 1
1: 0
2: 0
3: 21
4: 216
Right 1078947408 11:16085143-16085165 ACCCCTATTTGGCCATGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078947408 Original CRISPR ACCCCTATTTGGCCATGAAG AGG Intronic
904393469 1:30201277-30201299 ACTCCTATTTGACAATGTAGTGG - Intergenic
910624454 1:89291768-89291790 ACTCTTATGTGGTCATGAAGGGG + Intergenic
911266056 1:95744338-95744360 ACCCCTATTTGGCCATTCCCAGG + Intergenic
912482843 1:109997488-109997510 ACTCCTTTTTGGTCTTGAAGGGG + Intronic
915570320 1:156741798-156741820 AGCCCAAGATGGCCATGAAGTGG - Intergenic
920132063 1:203739983-203740005 ACCTCTACCTGACCATGAAGAGG + Exonic
1066198617 10:33125564-33125586 ACCCCTCTCTGGCCCTGGAGAGG - Intergenic
1067134062 10:43592873-43592895 AGCCCAAATTTGCCATGAAGAGG - Intergenic
1072895821 10:99365764-99365786 GACCCTATTTGGCATTGAAGTGG - Intronic
1073307467 10:102514693-102514715 ACAGCTAGCTGGCCATGAAGGGG - Intronic
1078947408 11:16085143-16085165 ACCCCTATTTGGCCATGAAGAGG + Intronic
1079329366 11:19521071-19521093 ACAGCCATTTGGCCATGAGGCGG + Intronic
1079977375 11:27108679-27108701 ATCCATATGTGGCCATGATGTGG - Intronic
1083889493 11:65588876-65588898 ACCCCCTTTTGGCCAGGAGGTGG + Intronic
1084658576 11:70533947-70533969 AACACTACTTGGCCATAAAGAGG - Intronic
1087885248 11:103473072-103473094 ACTTCTATTGGGGCATGAAGAGG + Intronic
1091203525 11:133801033-133801055 ACCCCCATTGGGTCATGACGAGG + Intergenic
1091951329 12:4595624-4595646 AACCAAATTTGGCCAGGAAGAGG + Intronic
1095920063 12:47520215-47520237 AGTACTATTTGGCCATGAAAAGG - Intergenic
1103479768 12:121243482-121243504 AATCTTATTTGGCCATGAAAAGG + Intronic
1108411484 13:50152546-50152568 ACCCCTATTGGGCAAGGAAATGG - Intronic
1110814622 13:79847599-79847621 ACTTCTATTTAGACATGAAGGGG + Intergenic
1112367205 13:98765367-98765389 AGCCCAAATTTGCCATGAAGAGG + Intergenic
1113239899 13:108325911-108325933 TACCCTATTTTGCCTTGAAGTGG + Intergenic
1202857353 14_GL000225v1_random:59419-59441 ACACCTAGCTGGCTATGAAGGGG + Intergenic
1124911277 15:33923645-33923667 AGCCATATTTGGCCCTCAAGTGG + Intronic
1128924342 15:71640706-71640728 ATCCTGATTTTGCCATGAAGCGG + Intronic
1128956549 15:71952971-71952993 AGCCATATTTGGCAATGGAGAGG + Intronic
1129370321 15:75089423-75089445 ACCCCTGGTTGGCCATGAGGTGG - Intronic
1131650734 15:94396051-94396073 TGCACTATTTGGCCATGAAAAGG + Intronic
1131973644 15:97918910-97918932 GCCCCAATTTGGAGATGAAGAGG + Intergenic
1132575983 16:664390-664412 AACAGTATTTGGCCATCAAGAGG - Intronic
1136066127 16:27760088-27760110 ACTTCTTTGTGGCCATGAAGAGG - Intronic
1143262824 17:5612842-5612864 ACCCCTATTTCGCCACCAAAAGG - Intronic
1149331564 17:55588012-55588034 GCCTCTCTTTGGCCACGAAGAGG + Intergenic
1152345842 17:79751109-79751131 AATACTATTTGGCCATGAAAAGG + Intergenic
1153092757 18:1367125-1367147 TCCCTGATTTGGCCAGGAAGTGG - Intergenic
1155570177 18:27184747-27184769 ACCCCTCTTGGGGCATGCAGAGG - Intronic
1156460289 18:37317937-37317959 ACCACGATATGGCCATGCAGTGG + Intronic
1159747545 18:72256610-72256632 ACACTTATATGGCCATAAAGTGG + Intergenic
1164862481 19:31573243-31573265 AACCCTATTTTGCCCTGATGCGG + Intergenic
927296972 2:21465966-21465988 CCCCCTGTTTGGCCATGGTGAGG + Intergenic
930027159 2:47036021-47036043 ACCCCTGAATGGCCATGAAAAGG + Intronic
931636030 2:64341412-64341434 AGACCTATCTGGCTATGAAGTGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
934738830 2:96704466-96704488 AGCACTATTTGGCCATGAGCTGG + Intergenic
935742977 2:106167254-106167276 ACTCCTATTTGGCCCTCATGTGG + Intronic
937433770 2:121863268-121863290 AGTACTATTTGGCCATGAAAAGG - Intergenic
939316692 2:140559646-140559668 CCCCCCATATGGCCATTAAGAGG - Intronic
941343818 2:164342281-164342303 ACCTCTTTTTGGCCATGACAAGG + Intergenic
944858573 2:203792271-203792293 ACTCCTAGTTAGCCAGGAAGAGG - Intergenic
945783835 2:214209163-214209185 ACCCTTATTTAGGCATGGAGAGG - Intronic
946600051 2:221349655-221349677 ACTCCTATGTGGCCAGGAAAGGG + Intergenic
948510718 2:238462639-238462661 AATACTATTTGGCCATGAAAAGG - Intergenic
1168814987 20:730174-730196 AGCCATGTTGGGCCATGAAGTGG - Intergenic
1170438298 20:16352471-16352493 ACCCCTGCTGGGCCATGAGGAGG - Intronic
1176028743 20:63000007-63000029 ACCCCTGATTGGCCCTGACGGGG - Intergenic
1178273409 21:31214536-31214558 ACCCCTATGTTGCCATGTTGAGG - Intronic
951005346 3:17609531-17609553 ACCCCTATGTGTTCATAAAGTGG - Intronic
962478566 3:135779031-135779053 AGCCCTATTTTGACAGGAAGAGG + Intergenic
964808455 3:160637326-160637348 ACACCTAATTGTTCATGAAGAGG + Intergenic
965910637 3:173770851-173770873 CCTGCTATTTTGCCATGAAGAGG + Intronic
966647098 3:182258734-182258756 ACTGCTTTCTGGCCATGAAGTGG + Intergenic
975055147 4:69920994-69921016 AACACTATTTGGCCATAAAAAGG - Intergenic
981854020 4:149265709-149265731 CCCCCTTTTTGGCCCTGGAGTGG - Intergenic
991036163 5:62130074-62130096 TCCAGTTTTTGGCCATGAAGAGG - Intergenic
991278261 5:64878143-64878165 AGCATTATTTGGCCATGAAAAGG - Intronic
993604908 5:89977503-89977525 ACCCCTGTATGGCAATGAATTGG + Intergenic
993754990 5:91717531-91717553 ACCACTACTTGGCCATAAAAAGG + Intergenic
994297352 5:98106578-98106600 ACATCTGTTTGGACATGAAGAGG - Intergenic
995984900 5:118159046-118159068 CCCATTATTTGGCCAAGAAGAGG + Intergenic
997841991 5:137250212-137250234 AACCCAATTTGGCCTTGTAGAGG - Intronic
999022221 5:148179409-148179431 AACCCTATTTGCCCATAAGGTGG + Intergenic
1002190856 5:177476817-177476839 ACCCCTATTTCTGCATGCAGGGG + Intergenic
1006403326 6:33830212-33830234 ACCATTATTTTACCATGAAGGGG + Intergenic
1007761158 6:44134498-44134520 CACCCTACTGGGCCATGAAGGGG + Intronic
1011059988 6:83254247-83254269 AGCCCTATTTGGCTATAATGTGG + Intronic
1014205213 6:118650474-118650496 ACCCCTAATTTTCCTTGAAGGGG + Intronic
1021656660 7:22880408-22880430 ACCCCCATCTGGCCAGGCAGTGG + Intergenic
1026264881 7:68787603-68787625 TCCCCAAATTGGCCATCAAGTGG - Intergenic
1032086636 7:128887147-128887169 ACTCCTCTCTGGCCAGGAAGAGG - Intronic
1035093893 7:156336534-156336556 GCCCCTACTTTGCCACGAAGAGG + Intergenic
1037427318 8:18770483-18770505 TCCCATATCTGCCCATGAAGGGG - Intronic
1037517823 8:19651203-19651225 ACCCTCATTTTGCCATGCAGTGG - Intronic
1044466332 8:92511175-92511197 ACTCCTATGTGGGCATGAAGAGG - Intergenic
1045280984 8:100749584-100749606 AGCTCTCTTTGGCCATGACGTGG + Intergenic
1047126374 8:121965658-121965680 ACCCCAATTTCACTATGAAGGGG - Intergenic
1049998241 9:1051040-1051062 ACCCCTCCTTGGGCTTGAAGAGG - Intronic
1055266375 9:74499105-74499127 ACCGCTGTGTGGCCAGGAAGAGG - Intronic
1056311056 9:85341312-85341334 ATCCCTGTTTGGCCATGTGGGGG + Intergenic
1189695908 X:43661805-43661827 AACACTATTTGGACATGAAGAGG - Intronic
1192795968 X:74423970-74423992 ACCACTATTTTACCAGGAAGAGG + Intronic
1202369529 Y:24187529-24187551 ACCTCTATGAGGCCATGTAGTGG - Intergenic
1202501256 Y:25482588-25482610 ACCTCTATGAGGCCATGTAGTGG + Intergenic