ID: 1078949105

View in Genome Browser
Species Human (GRCh38)
Location 11:16108741-16108763
Sequence CCACCTCAGTGGGTTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078949105_1078949111 8 Left 1078949105 11:16108741-16108763 CCCTCAGCAACCCACTGAGGTGG 0: 1
1: 1
2: 3
3: 26
4: 205
Right 1078949111 11:16108772-16108794 GCCTAGTGTTTACTACACGCTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1078949105_1078949114 28 Left 1078949105 11:16108741-16108763 CCCTCAGCAACCCACTGAGGTGG 0: 1
1: 1
2: 3
3: 26
4: 205
Right 1078949114 11:16108792-16108814 TGGGACTCTGAAATGCCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 201
1078949105_1078949113 9 Left 1078949105 11:16108741-16108763 CCCTCAGCAACCCACTGAGGTGG 0: 1
1: 1
2: 3
3: 26
4: 205
Right 1078949113 11:16108773-16108795 CCTAGTGTTTACTACACGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078949105 Original CRISPR CCACCTCAGTGGGTTGCTGA GGG (reversed) Intronic