ID: 1078949705

View in Genome Browser
Species Human (GRCh38)
Location 11:16116719-16116741
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1406
Summary {0: 1, 1: 26, 2: 248, 3: 448, 4: 683}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078949705_1078949711 6 Left 1078949705 11:16116719-16116741 CCAGGTTGTGGCCTGTTAGGAAC 0: 1
1: 26
2: 248
3: 448
4: 683
Right 1078949711 11:16116748-16116770 ACATAGCAGGAGGTAAGCAGCGG 0: 2
1: 15
2: 164
3: 457
4: 832
1078949705_1078949712 7 Left 1078949705 11:16116719-16116741 CCAGGTTGTGGCCTGTTAGGAAC 0: 1
1: 26
2: 248
3: 448
4: 683
Right 1078949712 11:16116749-16116771 CATAGCAGGAGGTAAGCAGCGGG 0: 1
1: 44
2: 429
3: 857
4: 1302
1078949705_1078949708 -7 Left 1078949705 11:16116719-16116741 CCAGGTTGTGGCCTGTTAGGAAC 0: 1
1: 26
2: 248
3: 448
4: 683
Right 1078949708 11:16116735-16116757 TAGGAACTGGACCACATAGCAGG 0: 1
1: 31
2: 288
3: 603
4: 1103
1078949705_1078949709 -4 Left 1078949705 11:16116719-16116741 CCAGGTTGTGGCCTGTTAGGAAC 0: 1
1: 26
2: 248
3: 448
4: 683
Right 1078949709 11:16116738-16116760 GAACTGGACCACATAGCAGGAGG 0: 1
1: 29
2: 265
3: 598
4: 1080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078949705 Original CRISPR GTTCCTAACAGGCCACAACC TGG (reversed) Intronic
900587296 1:3439521-3439543 GTTCCTAACAGGCCAAGAACTGG + Intergenic
900711319 1:4116424-4116446 GTTCCTAATGGGCCACAGACTGG + Intergenic
901714267 1:11140497-11140519 GTTCCTAACAGGCTACTCACCGG + Intronic
901863988 1:12092018-12092040 GTTCCTAACAGGCCATGGACTGG + Intronic
902197799 1:14810696-14810718 GTCCCCAACAAGCCACACCCTGG - Intronic
902536949 1:17124790-17124812 GTTCCCAACAGACCACAGACTGG + Intergenic
902592710 1:17486407-17486429 GTTCCTAACAGGCCACAGACAGG - Intergenic
902600127 1:17535381-17535403 GTTCCTAACAGGCCACAGCCTGG + Intergenic
902803830 1:18848539-18848561 GTTCCTAACAGGCCACAGACTGG - Intronic
903043358 1:20548694-20548716 GTTCCTAACTGGCTACAGACTGG - Intergenic
903060781 1:20667103-20667125 GTTCCTAACAGGCCAGGGACTGG - Intronic
903088402 1:20885155-20885177 GTTCCCAACAGGCCACTGACTGG + Intronic
903139087 1:21327754-21327776 GTTCCTAACAGGCCATGGACTGG - Intronic
903442925 1:23401791-23401813 GTTCCTAACAGGCCACAGACTGG - Intronic
903525173 1:23987773-23987795 CTTCCTAACAGGCCGCAGACTGG + Intergenic
903701979 1:25255956-25255978 GTTCCTAACAGGCCACAAATGGG + Intronic
903703827 1:25270325-25270347 GTTCCTAACGGGCCACAGCCTGG - Intronic
903723416 1:25422999-25423021 GTTCCTAACGGGCCACAGCCTGG + Intronic
904247498 1:29198228-29198250 GTTCCTAACAGGCCACGAACTGG + Intronic
904737717 1:32647503-32647525 GTTCCTAACAGGCCACCAACTGG - Intronic
905378108 1:37538803-37538825 GTTCCTAACAGGCCACGGACTGG - Intronic
905688917 1:39928411-39928433 GTTCCTAACAGACCACAGACCGG - Intergenic
905763581 1:40581404-40581426 GTTCCTAACAGGCCACAGACTGG - Intergenic
907057455 1:51383661-51383683 GTTCCTAACAGGCCACAGACTGG + Intronic
907121916 1:52015484-52015506 GTTCCTAACAGGCCATGGACAGG + Intergenic
907127402 1:52063047-52063069 GTTCCTAACAGGTCACAGACTGG + Intronic
907222686 1:52918877-52918899 GTTCCTAGCAGGCCACAGACTGG - Intronic
907733622 1:57090796-57090818 GTTTCTAACAGGCCACAGATTGG - Intronic
907892198 1:58647024-58647046 GCTCCTAACAGGCCACGGACTGG + Intergenic
907911176 1:58828096-58828118 GTTCCTAACAGGCCACAGATGGG - Intergenic
908155134 1:61345537-61345559 GTTCCTAACAGGCCACTGACTGG - Intronic
908172183 1:61516297-61516319 GTTCCTAACAGGCCACAGACTGG - Intergenic
908309032 1:62857145-62857167 GTTCCTAACAGGCCACAGACTGG - Intronic
908343399 1:63205874-63205896 GTTCTTAACAGGCCACAGACTGG - Intergenic
908491163 1:64645610-64645632 CTTCCCAGCAGGCCCCAACCTGG - Intronic
908588689 1:65604670-65604692 GTTCCTAAGAGGCCACAGACAGG - Intronic
908831704 1:68185435-68185457 GTTCCTAACAGGCCACTGACTGG - Intronic
909221601 1:72969310-72969332 GTTCCTAACAGGCCACAGACAGG + Intergenic
909329365 1:74393976-74393998 GTTTCTAACAGGCCACAGGTTGG + Intronic
909423043 1:75487825-75487847 GTTCCTAACAGGCCATGGACTGG - Intronic
909516029 1:76508350-76508372 GTTCCTAACAGGCCAGGGACAGG + Intronic
909617397 1:77626609-77626631 GTTCCTAACAGGCCATGGACTGG + Intronic
909660508 1:78076657-78076679 GTTCCTAACAGGCCAAGGGCTGG + Intronic
910485184 1:87705335-87705357 GTTCCTAACAGGCCATGCTCAGG - Intergenic
910590238 1:88922423-88922445 GTTCCTAACAGGTCACCAGCTGG - Intergenic
910953744 1:92679004-92679026 GTTCCTAACAGGCCACAGACTGG - Intronic
911147078 1:94562760-94562782 GTTCCTAACAGGCCATGGACTGG + Intergenic
911150611 1:94594154-94594176 GTTCCTAACAGGCCACGGACCGG - Intergenic
911573031 1:99540626-99540648 GTTCCTAACAGGCCATGAACAGG + Intergenic
911894031 1:103406488-103406510 GTTCCTAACAGGCCAGGGACTGG - Intergenic
912216412 1:107618189-107618211 GTTCCTAACAGGCCACAGTCTGG + Intronic
912558690 1:110534831-110534853 CATCCATACAGGCCACAACCGGG + Intergenic
912750365 1:112282546-112282568 GTTCCTAACAGGCTCCTAGCTGG + Intergenic
912750372 1:112282574-112282596 GTTCCTAACAGGCCATGGACTGG + Intergenic
913230367 1:116736002-116736024 GTTCCTAACAGGCCATGGACCGG - Intergenic
913325021 1:117620604-117620626 GTTCCTAACAGGCCACGGACTGG - Intronic
913554624 1:119952715-119952737 GTTCCTAACAGGCCACACACAGG + Intronic
914335776 1:146713962-146713984 GTTCCTAACAGGCCACAAACTGG - Intergenic
914698568 1:150108894-150108916 GTTCCTAACAGACCACGGACTGG + Intronic
914760353 1:150593628-150593650 GTTCTTAACAGGCCATGAACTGG + Intergenic
915280664 1:154820143-154820165 GTTGCTGACAGCCCAGAACCTGG - Intronic
916296100 1:163222157-163222179 GTTCCTAACAGGTCACGAACTGG - Intronic
916303573 1:163303695-163303717 GTTCCTAACAGGCCACAGACCGG - Intronic
916705660 1:167346736-167346758 GTTCCTAGCAGGCCACAGATTGG + Intronic
917098947 1:171426786-171426808 GTTCCTAACAGGCCACAGACTGG + Intergenic
917205595 1:172567913-172567935 GTTCCTAACAGGCCATGGACTGG - Intronic
917231891 1:172846396-172846418 GTTCCTAACAGGCTACAGACTGG - Intergenic
917543708 1:175940207-175940229 GTTCCTAACAGGCCACGGACTGG + Intergenic
917562674 1:176175630-176175652 GTTCCTAATAGGCCACAGACTGG + Intronic
917850593 1:179060395-179060417 GTTCCTACCACGCCACAGACTGG - Intronic
917987159 1:180332357-180332379 GTTCCTAACAGGCCATGGACAGG - Intronic
918287556 1:183072640-183072662 GTTCCTAACAGGCCACAGACTGG - Intronic
918435922 1:184512811-184512833 GTTTCTAACAGGCCACCGACTGG - Intronic
918460116 1:184767755-184767777 GTTCCTAACAGGCCACTGATGGG - Intergenic
918555639 1:185796322-185796344 GTTCCTAAGAGGCCACGGACTGG + Intronic
918576582 1:186068136-186068158 GTTCCTAATAGGCCACAGGCTGG + Intronic
918699406 1:187589244-187589266 GTTCCTAACAGGTCACAGACAGG - Intergenic
918751169 1:188271216-188271238 GTTCCTAACACGTCACGAACTGG + Intergenic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
919099061 1:193071238-193071260 GTTCCTAACAGGCCACGGACTGG + Intronic
919515853 1:198521883-198521905 GTTCCTAACAAGCCACAGACAGG - Intergenic
919811543 1:201411948-201411970 GTTCCTAACAGGCCACGGACAGG + Intronic
919967116 1:202538931-202538953 TTTCCTAAGATGCCACAATCGGG - Intronic
919996605 1:202757265-202757287 GTTCCTAACAGGCCACCGACTGG + Intronic
920550377 1:206855663-206855685 GTTCCTAACAGGCCACCAACCGG + Intergenic
921006018 1:211094348-211094370 GTTCCTAACAGGCCATGGACTGG + Intronic
921016360 1:211195634-211195656 GTTCCCAACAGGCCACGGACTGG - Intergenic
921377739 1:214491643-214491665 GTTCCTAACAGGCCAGGGACTGG + Intronic
921402340 1:214739133-214739155 GTTTCTAACAGGCCACGGACTGG + Intergenic
922031171 1:221800974-221800996 GTTCCTAACAGACCACAGACAGG - Intergenic
922085011 1:222338159-222338181 GTTCCTAACAGGGAACAGACTGG + Intergenic
922275239 1:224071436-224071458 GTTCCTAACAGGCCATGGACCGG - Intergenic
922275343 1:224072409-224072431 GTTCCTAACAGGCCATGGACCGG + Intergenic
922328922 1:224556780-224556802 GTTCCTAACACGCCACGGACCGG + Intronic
922329349 1:224560424-224560446 GTTCCTAACAGGCCACAGAGTGG - Intronic
922614304 1:226952202-226952224 GCTCCTAACAGGCCACCAGGCGG - Intronic
923618421 1:235557090-235557112 GTTCCTAACAGGCCACAGACTGG + Intronic
923704427 1:236332526-236332548 GTTCCTAACAGGCCACAGACTGG - Intergenic
923826129 1:237502715-237502737 GTTCCTAACAGGCCGCGGACTGG + Intronic
924030179 1:239878508-239878530 GTTCCTAACAGGCCACAGACTGG + Intronic
924072723 1:240298504-240298526 GTTCCTAACAGGCCACAGAATGG - Intronic
924770386 1:247074829-247074851 GATCCTAACAGGCCACCGACAGG + Intronic
1063356365 10:5402617-5402639 GTTCCTAACAGGGCACAGACTGG - Intronic
1064089035 10:12367833-12367855 GTTCCTAACAGGCCATGGACTGG + Intronic
1064104415 10:12489249-12489271 GTTTCTAACAGGCCACAGACTGG + Intronic
1064119930 10:12609743-12609765 GTTTCTAACAGGCCACAGACTGG + Intronic
1064204388 10:13310973-13310995 GTTCCTAACAGGGTACAGACTGG - Intergenic
1064269405 10:13851403-13851425 ATTCCTAACAGGCCATAGACTGG - Intronic
1064303856 10:14147763-14147785 TTTCCTAACAGGCCACGGACTGG + Intronic
1064473446 10:15661077-15661099 GCTCCCAACAGGCCACAGACAGG - Intronic
1064781269 10:18841407-18841429 GTTCCTAACAGGCTACAGAGTGG + Intergenic
1065307317 10:24381389-24381411 TTTCCTAACAGGCCACAGACTGG - Intronic
1065368398 10:24956778-24956800 GTTCCTAACAGGCCACAGGCTGG - Intergenic
1065408839 10:25398927-25398949 GTTCCTAACAGGCCATGAACTGG - Intronic
1065666142 10:28063541-28063563 GTTCCTAACAGGCCACAGACTGG - Intronic
1065672525 10:28135888-28135910 GTTCCTAACAGGTCATAAGCGGG - Intronic
1065931530 10:30483563-30483585 GTTCCTAACAGGCCATGGACTGG - Intergenic
1066147728 10:32578737-32578759 GTTCCTAACAGGCCATGGACTGG + Intronic
1066199536 10:33131812-33131834 GTTCCTAACAGGCTACAGACTGG + Intergenic
1066214152 10:33269610-33269632 GTTCCTAACAGACCACAAACTGG - Intronic
1066542528 10:36463529-36463551 GTTCCTAACAAACCACAGACAGG - Intergenic
1066612393 10:37263745-37263767 GTTCCTAACAGGCCATGGTCTGG + Intronic
1067075445 10:43177574-43177596 GTACCTAACATGTCACAACATGG - Intronic
1067139228 10:43642435-43642457 GTTCCTAACAGGCCACAGACTGG - Intergenic
1067250952 10:44586919-44586941 GTTCCTAACAGGCCACGGACTGG - Intergenic
1068163531 10:53299036-53299058 GTTCCTACCAGGCCACAGACTGG + Intergenic
1068194166 10:53694638-53694660 GTTCCTAACAGGCCAAGGACTGG + Intergenic
1068250040 10:54426514-54426536 GTTCCTAACAGGCCACGGAACGG + Intronic
1068334841 10:55621437-55621459 GTTCCTAACAGGCCATGAACAGG - Intronic
1068374975 10:56166036-56166058 GTTCCTTACAGGCCACAAATTGG + Intergenic
1068544294 10:58328518-58328540 GTTCCTAACAGGCCACAGACTGG + Intergenic
1068630066 10:59289286-59289308 GGTCCTAACAGGCTACAGGCCGG + Intronic
1068676335 10:59773404-59773426 GTTCCTAACAGGCCACAGATGGG - Intergenic
1068819653 10:61359593-61359615 GTTCCTAACAGGCCATGGACTGG - Intergenic
1069136470 10:64772918-64772940 GTTCCTAACAGGCCACAGACTGG - Intergenic
1069372237 10:67760588-67760610 GTTCCTAACAGGCCACGGACCGG - Intergenic
1069572307 10:69501737-69501759 GTTCCTAACAAGCCACTGACCGG - Intronic
1070097791 10:73355152-73355174 GTTCCTGACAGGCCACGGGCTGG - Intronic
1071318594 10:84428465-84428487 GCTCCTAACAGACCACAGACTGG + Intronic
1071358393 10:84820915-84820937 GTTCCTCATAGGACACACCCTGG - Intergenic
1071909174 10:90211509-90211531 GTTCCTAACAGGCCATGGACTGG + Intergenic
1072225069 10:93361291-93361313 GTTCCTAAAAGGCCATGAACTGG + Intronic
1072332728 10:94369466-94369488 GTTCCTAACAGGCCGCGGACTGG + Intergenic
1072892750 10:99339427-99339449 GTTCCTACCAGGCCACAAACTGG - Intronic
1072990428 10:100187106-100187128 GTTCCTAACAGGCCACTGTCTGG + Exonic
1073199953 10:101727273-101727295 GTTCCTAACAGGCCATGGACTGG + Intergenic
1073276454 10:102315745-102315767 GTTCCTAATGGGCCACAGACTGG + Intronic
1073682528 10:105719635-105719657 GTTCCTAACAGGCCATGGACTGG + Intergenic
1073839290 10:107480006-107480028 GTTCCTCACAAGCCACAGACTGG + Intergenic
1074124519 10:110517451-110517473 GTTCCTAACAGGCCTCTGACTGG - Intergenic
1074139609 10:110660440-110660462 GTTCCTAACAGGCCACAGCCTGG - Intronic
1074610260 10:115014985-115015007 CTTCCTAACAGGTCACAGACTGG + Intergenic
1074994735 10:118746924-118746946 GTTCCTTACAGGCCACCGACCGG - Intronic
1075237323 10:120742501-120742523 GTTCCTAACAGGCCACGGACTGG - Intergenic
1075291428 10:121234402-121234424 GTTCCTAACAAGCCACGGACCGG + Intergenic
1075853061 10:125604174-125604196 GTTCCTAACAGGCCACCAACTGG - Intronic
1075880648 10:125847963-125847985 GTTCCTAACAGGCCACGAACTGG + Intronic
1075917638 10:126182911-126182933 GTTCCTAACAGGCCACGGACAGG - Intronic
1075977912 10:126712814-126712836 GTTCCTAATGGGCCACAAACTGG - Intergenic
1076201370 10:128561271-128561293 GCTCCTAACAGGCCACTGACTGG + Intergenic
1076314252 10:129529529-129529551 TTTCCTAACAGGCCACGGACTGG + Intronic
1076343887 10:129767448-129767470 GTTCCTAGCATCCCACACCCAGG + Exonic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1077426468 11:2481526-2481548 GTTCCTAACAGGCCATGGACTGG - Intronic
1077448116 11:2612130-2612152 GTTTCTAATAGGCCACAGACTGG - Intronic
1077946339 11:6904287-6904309 GTTCCTAACAGGCCAGGAATTGG + Intergenic
1078009588 11:7562190-7562212 GTTCCTAACAGGCCATGGACTGG + Intronic
1078095057 11:8291712-8291734 GTTCCTATCAGGCCTCCTCCAGG - Intergenic
1078097278 11:8307756-8307778 GTTCCTAACAGACCACAGACTGG - Intergenic
1078116996 11:8463470-8463492 GTTCCTAACAGGCCACGGACAGG + Intronic
1078174083 11:8955743-8955765 GTTCCTAACAGACCACAGACTGG + Intronic
1078248078 11:9594565-9594587 GTTCCTAACAGGGCACGAACTGG + Intergenic
1078330272 11:10413561-10413583 GTTCCTAACAGGCCATGGACAGG + Intronic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1078812660 11:14783889-14783911 GTTCCTAACAGGCCACAGACCGG - Intronic
1078949705 11:16116719-16116741 GTTCCTAACAGGCCACAACCTGG - Intronic
1079357984 11:19745861-19745883 GTTCCTAACAGGCCATACAATGG + Intronic
1079578928 11:22037713-22037735 GTTGCTAACAGGCCAGGAACTGG + Intergenic
1079666045 11:23106983-23107005 GTTCCTAACAGGCCATGAACAGG - Intergenic
1079785912 11:24672849-24672871 GTTCCTAACAGGCCACGGATTGG - Intronic
1079870428 11:25792300-25792322 GTTCCCAACAGGCCACAGACTGG - Intergenic
1080031190 11:27662805-27662827 GTTCCTAACAGGCCAGGGACTGG + Intronic
1080190827 11:29546676-29546698 GTTCCTAACAGGCCATGGACTGG - Intergenic
1080293508 11:30698528-30698550 GTTCCTAACAGGCCATGGACAGG + Intergenic
1080471499 11:32550308-32550330 GTTCCTAACAGGCCACAGATCGG - Intergenic
1080512405 11:32987961-32987983 GTTGCTAACAGGCCACAGACTGG - Intronic
1080884483 11:36353819-36353841 ATTCCTAACAGGCCACAGACTGG + Intronic
1081023689 11:37981828-37981850 GTTCCTGACAGGTCACAGACTGG - Intergenic
1081263652 11:40991900-40991922 GTTCCTAACAGGCCACCAACTGG + Intronic
1081263659 11:40991937-40991959 GTTCCTAAGAGGCCACCAACTGG + Intronic
1081294180 11:41365049-41365071 GTTCCTAACAGGCCACAAACTGG - Intronic
1081381811 11:42425559-42425581 GTTCCTAACAGGGAATTACCTGG + Intergenic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1082740837 11:56909236-56909258 GTTCCTAACAGACCACAGACTGG + Intergenic
1082841458 11:57693418-57693440 GTTCCTAACAGGCCATGAACCGG + Intronic
1083020023 11:59497169-59497191 GTTTCTAACAGGCCAAAAGCTGG + Intergenic
1083149701 11:60784066-60784088 GTTCCTAACAGGCCACAGACTGG - Intergenic
1084984895 11:72860207-72860229 GTTCCTAACAGGCCATGGACCGG + Intronic
1085382710 11:76134884-76134906 GTTCTTAACAGGCCACAGACGGG - Intronic
1085587574 11:77724880-77724902 GTTCCTAACAGGTTACAGACTGG + Intronic
1085723396 11:78932911-78932933 GTTCCTAACAGGCCACGGTCCGG + Intronic
1086489864 11:87348440-87348462 GTTCCTAACAGACCACTGACCGG - Intergenic
1086665586 11:89477463-89477485 GTTCCTAACAGGCCACGAACTGG + Intronic
1087180694 11:95139458-95139480 ATTTGTAACAGTCCACAACCGGG + Intergenic
1087343802 11:96943097-96943119 GTTCCTAACAGGTCACTGACTGG + Intergenic
1087796941 11:102464182-102464204 GTTCCTGACAGGCCACGAACAGG - Intronic
1087812485 11:102623290-102623312 GTTCCTAACAGGCCACAGACTGG - Intronic
1087854811 11:103078994-103079016 GTTTCTAACAGGCCACAGGCTGG - Intronic
1088110978 11:106260981-106261003 GTTCCTAACAGGCCCCTATGAGG + Intergenic
1088341463 11:108772642-108772664 GTTCCTAACAGGCCACAGACCGG - Intronic
1088472191 11:110198455-110198477 GTTCCTAACAGGCCACACGCCGG - Intronic
1088736249 11:112729960-112729982 GTTCCTAACGTGCCACACACTGG - Intergenic
1088786412 11:113186168-113186190 GTTTCTAACAGGCCATGGCCTGG - Intronic
1089095137 11:115913793-115913815 GTTCCTAACAGGCCACAGACTGG - Intergenic
1089101323 11:115965112-115965134 GTTCCTAACAGGCCACAGACTGG + Intergenic
1089308203 11:117540187-117540209 GTTACTAACAGGCCACGAACAGG - Intronic
1089993760 11:122885178-122885200 GTTCCTATCTAGTCACAACCTGG + Intronic
1090122007 11:124039694-124039716 GTTCCTAACAGGCCATGGACCGG - Intergenic
1090664652 11:128906463-128906485 GTTCCCACAAGGCCAAAACCAGG + Intronic
1090901646 11:131037568-131037590 GTTCCTAACAGGCCACAGACCGG + Intergenic
1091307344 11:134544826-134544848 GTTCCTAACAGGCCACGAACGGG + Intergenic
1091457116 12:616311-616333 GTAACTTACAGGACACAACCTGG - Intronic
1091513986 12:1159466-1159488 GTTCCTAACAGGCCACAGACCGG + Intronic
1091536402 12:1414154-1414176 GTTCCCAACAGGCCACGGACAGG + Intronic
1091643780 12:2257614-2257636 GTTCCTAACAGGCCATGGACCGG + Intronic
1091755243 12:3047060-3047082 GTTCCTAACAGGCCACGGATGGG - Intergenic
1091944084 12:4519662-4519684 GTTCCTAACAGGCCTGTACGGGG - Intronic
1092099490 12:5871448-5871470 GTTCCTGACAGGCCTCAGACTGG - Intronic
1092110606 12:5960868-5960890 GTTCCTAACAGGCCACTGACCGG - Intronic
1092194909 12:6543299-6543321 GTTCCTAACAGGCCACAGACAGG - Intronic
1092392308 12:8091679-8091701 GTTTCTAACAGGCCACAGACTGG + Intronic
1092734261 12:11565297-11565319 GTTCCTAACAGGCCATCAACAGG - Intergenic
1092766098 12:11854354-11854376 GTTCCTAACAGGCCATGGACTGG + Intronic
1092776182 12:11946798-11946820 GTTCCTAACAGGCCATGGTCTGG - Intergenic
1092805343 12:12217083-12217105 GTTCCTAAAAGGCCATGAACTGG - Intronic
1093065828 12:14657097-14657119 GTTCCTAACAGGCCATGGACTGG + Intronic
1093168199 12:15829510-15829532 GTTCCTACCAGACCACAGACCGG + Intronic
1093746655 12:22749925-22749947 GTTCCTAACAGGCCATGGACAGG + Intergenic
1094066185 12:26363035-26363057 GTTCCTAACAGGCCACAGACTGG - Intronic
1094075156 12:26464510-26464532 GTTCCTAACAGGCCACAGACTGG + Intronic
1094251885 12:28371188-28371210 GTTCCTAACAGGCCACGAAATGG - Intronic
1094344139 12:29448284-29448306 GTTCCTAACAGGCCATGAGTTGG + Intronic
1094645773 12:32322576-32322598 GTTCCTAATAGGCCACAAACTGG + Intronic
1094689181 12:32751866-32751888 GTTCCTAACAGGCCACGGACTGG + Intronic
1094695832 12:32817822-32817844 GTTCCTAACAGTCCACGGACTGG - Intronic
1095177595 12:39111100-39111122 GTTCCTAACAGGCCACAGACTGG - Intergenic
1095184096 12:39180696-39180718 GTTCCTAACAGGCCATAGACTGG + Intergenic
1095184325 12:39184459-39184481 GTTCCTAACAGGCCATGGACTGG - Intergenic
1095203080 12:39408414-39408436 GTTCCTAGCAGGCCACAGACTGG + Intronic
1095654333 12:44650979-44651001 GTTCCTAACAGGCCACAGACTGG - Intronic
1095695827 12:45143010-45143032 ATTCCTAACAGGCCACAGACTGG + Intergenic
1095811336 12:46375346-46375368 GTTCCTAACAGGCTTCAGACTGG - Intergenic
1095914830 12:47467240-47467262 GTTCCTAACAGGCCACAGACTGG + Intergenic
1096341111 12:50800501-50800523 GTTCCTAATAGGCCACAGACAGG - Intronic
1096431713 12:51549748-51549770 GTTCCTAACAGGCCACAGACAGG - Intergenic
1097032130 12:56097352-56097374 GTTCCTAACAGGCCATGGACTGG - Intronic
1097050093 12:56217641-56217663 GTTCCTGATAGGCCACAGTCTGG - Intronic
1097110337 12:56653233-56653255 GTTCCTAACAGGCCATGGACGGG - Intergenic
1097580896 12:61455034-61455056 GTTCCTAACAGGCCACAGCTTGG + Intergenic
1097748295 12:63324116-63324138 GTTTCTAATAGGCCACAGACTGG - Intergenic
1097809938 12:64007508-64007530 GTTCCTAACAGGCCACGGACTGG + Intronic
1098314402 12:69178000-69178022 GTTCCTAACAGGCCAGAGACTGG + Intergenic
1098658020 12:73057573-73057595 GGTCCTACCAGGCCACAGACTGG - Intergenic
1098915666 12:76254445-76254467 GTTCCTAACAGGCCATGCACTGG + Intergenic
1099155312 12:79168064-79168086 GTTCCTAACAGGCCATGGACTGG + Intronic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099270068 12:80497491-80497513 GTTCCTAACAGGCCACCAGCTGG + Intronic
1099317776 12:81106107-81106129 GTTCCTAACAGGCCACAGACTGG - Intronic
1099352816 12:81593890-81593912 GTTCCTAACAGGCCATGGACAGG - Intronic
1099467954 12:83010075-83010097 GTTCCAAACAGGCCATGAACTGG + Intronic
1099814288 12:87625330-87625352 GTTCCTAACAGGCGACGAACAGG - Intergenic
1099871614 12:88356478-88356500 GCTCCTAATAGGCCACAGACTGG - Intergenic
1099970628 12:89496303-89496325 GTTCCTAACAGGCCATGGACTGG + Intronic
1099974701 12:89534174-89534196 GTTCCTAACAGGCCATGGACCGG + Intergenic
1100162132 12:91872710-91872732 GTTCCTAACAGTCCATAGACTGG - Intergenic
1100173912 12:92007927-92007949 GTTCCTAACAGGCCATGGACTGG - Intronic
1100230824 12:92605255-92605277 GTTCCTAACAGGCCATAGACTGG - Intergenic
1100341594 12:93684495-93684517 GTTCCTAATAGGCCACGGACCGG + Intronic
1100386694 12:94110434-94110456 GATCCTAATAGGCCACAAACTGG - Intergenic
1100449775 12:94694824-94694846 GTTCCTAACAGGCCATGCACGGG - Intergenic
1100456862 12:94760126-94760148 GTTCCTAACAGGCCACAGATCGG + Intergenic
1100547822 12:95620197-95620219 GTTCCTAACAGACCACAGACCGG + Intergenic
1100688431 12:97012036-97012058 GTTCCTAACAGGCCAAAGACTGG - Intergenic
1100986123 12:100203199-100203221 GTTCCCAACAGACCACAGACAGG + Intronic
1101026454 12:100611778-100611800 ATTGCTAACAGGCCACAGACCGG + Intronic
1101089480 12:101270402-101270424 GTTCCTAACAGGCCATGAACCGG - Intergenic
1101374213 12:104157008-104157030 GTTCCTAACAGGCCACAGGCTGG + Intergenic
1101399005 12:104372299-104372321 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1101658094 12:106742012-106742034 GTTCCTAACAGGCCACGGTCCGG + Intronic
1101676956 12:106926005-106926027 ATTCCTAACAGGCCACGGACTGG + Intergenic
1101976709 12:109365842-109365864 GTTCCTAACAGGCCACGGACCGG - Intronic
1102329170 12:112014193-112014215 GTTTCTAACAGGCCACCGACGGG - Intronic
1102431396 12:112886567-112886589 GTTCCTAACAGGCCACAGACTGG + Intronic
1102474174 12:113177939-113177961 CTTTCTAACAGCCCACAGCCAGG + Intronic
1102601733 12:114036629-114036651 CTTCCTAACAGGCCACAGACTGG - Intergenic
1103161351 12:118731899-118731921 GTTCCTAACAGACCACAGACTGG - Intergenic
1103214292 12:119189725-119189747 GTTCCTAACAGGCCACAGATGGG + Intronic
1103429038 12:120865788-120865810 GTTTCTAACAGGCCACTAACTGG - Intronic
1103860008 12:124004613-124004635 GTTCCTAACAGGCCATGGACTGG - Intronic
1103865344 12:124047324-124047346 GTTCCTAACAGGCCAAAGACAGG - Intronic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1104466122 12:128992393-128992415 GTTCCTAACAGGCCACAGGCCGG + Intergenic
1104510364 12:129372312-129372334 GTTCCTAACAGGCCATGGACTGG - Intronic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1104722227 12:131050960-131050982 GTTCCTAACAGGCCACGGGCTGG + Intronic
1105064254 12:133182933-133182955 GTTCCTAACAGACCACAGACTGG - Intronic
1105203847 13:18202831-18202853 GTTCCTAACAGGACACGAACCGG - Intergenic
1105373333 13:19819960-19819982 GTTCCTAACAGGCCACAGCCAGG + Intergenic
1105447185 13:20467843-20467865 GTTCCTAACAGGCCAGGGACCGG - Intronic
1105669841 13:22600829-22600851 GATTCTAACAGGCCACAGGCTGG + Intergenic
1105863490 13:24438400-24438422 GTTCCTAACAGGCCAGGGACTGG + Intronic
1106195303 13:27488536-27488558 GTTCCTAACAGGTCACGGACTGG + Intergenic
1106457153 13:29937440-29937462 GTTCCTAACAGGCCACAGACTGG - Intergenic
1106658314 13:31771261-31771283 GTTCCTAACATGCCACAGACTGG - Intronic
1106821288 13:33467483-33467505 GTTCCTAACAGGCCATGGACTGG + Intergenic
1106832743 13:33602649-33602671 GTTCCTAACAGGCCACAGACCGG - Intergenic
1106975259 13:35204023-35204045 GTTCCTGACAGGCCACAGACCGG - Intronic
1106985516 13:35343528-35343550 GTTCCTAACAGGCCAAGGACTGG - Intronic
1106999059 13:35522614-35522636 GTTCCTAAAAGGCCATAGACTGG - Intronic
1107340340 13:39398679-39398701 GTTCCTAACAGGCCAGGGACTGG - Intronic
1107446187 13:40472083-40472105 ATTCCTAACAGGCCACATACTGG - Intergenic
1107506621 13:41040743-41040765 GTTCCTAACAGGCCACGGATGGG + Intronic
1107515772 13:41127443-41127465 GTTCCAAACAGGCCACAGACTGG + Intergenic
1107609620 13:42100028-42100050 GTTCCTCACAGGCCACGGACTGG - Intronic
1107749568 13:43550189-43550211 GTTCCTAACAGGCCACAAACTGG + Intronic
1107797217 13:44065085-44065107 GTTCCTAACAGGCCACGGGCTGG + Intergenic
1108015857 13:46074993-46075015 GTTCCTAACAGGCCATGGACTGG + Intronic
1108119799 13:47172369-47172391 GTTCCTAACAGGCCATGCACAGG + Intergenic
1108333356 13:49412930-49412952 GTTCCTAACAGGCCATGGACAGG + Exonic
1108346821 13:49554542-49554564 GTTCCTAACAGGGCACGGACTGG - Intronic
1108608210 13:52061334-52061356 GTTCCTAACAGGCCACAGACTGG + Intronic
1109111613 13:58327721-58327743 GTTCCTAACAGGCCATGGGCCGG - Intergenic
1109131915 13:58597769-58597791 GTTCTCAACAGGCCACAAAGAGG + Intergenic
1109282260 13:60370591-60370613 GTTCCTAACAGGACACAGACTGG + Intergenic
1109830549 13:67781425-67781447 GTTCCTAACAGGCCACGGACTGG + Intergenic
1110077725 13:71269887-71269909 GTTCCTAACAGGCCACGGACAGG + Intergenic
1110232559 13:73182118-73182140 GTTCCTAACAGGCCACGAACTGG + Intergenic
1110330883 13:74270963-74270985 GTTCCTAACAGGCCATGAACCGG - Intergenic
1110419071 13:75284575-75284597 GTTCATAACAGGCCACAGACAGG + Intergenic
1110745121 13:79043461-79043483 GTTCCTAACAGGCCATGGACTGG + Intergenic
1110754192 13:79152367-79152389 GTTCCTGGCAGGCCACAGACTGG - Intergenic
1110763033 13:79251672-79251694 GTTCCTAACAAGTCACAGACCGG + Intergenic
1110892862 13:80712083-80712105 TATCCTAACAAGCCACAAACTGG - Intergenic
1111183747 13:84701719-84701741 GTTCCTAATAGGCAACAGACTGG + Intergenic
1111201250 13:84940319-84940341 GTTCCTAACAGACCATCAACTGG - Intergenic
1111454632 13:88464970-88464992 GTTCCTAACAGGCCAGGGACTGG - Intergenic
1111592797 13:90371445-90371467 GTTCCTAACAGGTCACCATCCGG + Intergenic
1111694080 13:91601468-91601490 GTTCCTAACAGGCCACGGACTGG - Intronic
1112032999 13:95474426-95474448 GTTCCTAACAGGCCACAGACTGG + Intronic
1112057851 13:95707268-95707290 GTTCCTAACAGGCCATGGACTGG + Intronic
1112095468 13:96127522-96127544 GTTCCTAACAGGCGACGGACTGG + Intronic
1112581363 13:100678947-100678969 GTTCCTAACAAGCCATAGACAGG - Intergenic
1112594396 13:100794696-100794718 GTTCCCAACAGGCCAAAAACTGG - Intergenic
1112804453 13:103147948-103147970 GTTCCTCACAGGACACTAGCAGG - Intergenic
1112917125 13:104565445-104565467 GTTTCTAACAGGCCACAGACTGG + Intergenic
1113658401 13:112085984-112086006 GTTCCTAACAGGCCATGGACAGG + Intergenic
1113973364 13:114207676-114207698 GTTCCTAACAGGCCACAGACTGG + Intergenic
1114028566 14:18554452-18554474 GTTCCTAACAGGCCATTAATGGG + Intergenic
1114139926 14:19897941-19897963 GTTCCTAACAGTCAATATCCAGG + Intergenic
1114274087 14:21125989-21126011 GTTCCTAACAGGCCACCGACTGG - Intergenic
1114373289 14:22113646-22113668 GTTCCTAACAGGCCACAGAATGG + Intergenic
1114576576 14:23719744-23719766 GTTCCTAACAGGCCATGAACCGG - Intergenic
1114863776 14:26561203-26561225 GTTCTTAGCAGGCCACAGACCGG + Intronic
1115094844 14:29622261-29622283 GTTCCTAACAGGCCACGTACAGG + Intronic
1115202566 14:30870465-30870487 GTTGCCAACAGGCCACAGACTGG - Intergenic
1115275964 14:31608816-31608838 GTTTCTAACAGGCCACAGACTGG + Intronic
1115332046 14:32208385-32208407 GTTCCGAACAGGTCACAGACAGG - Intergenic
1115739864 14:36376780-36376802 GTTCCTAACAGGCCACTGAATGG + Intergenic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1116574535 14:46556207-46556229 GTTCCTAATAGGCCATAGACTGG + Intergenic
1117281173 14:54242496-54242518 GTTCCTAACAGGACACAAACTGG + Intergenic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1117574969 14:57088516-57088538 GTCCCTAACAGGCCACAGACTGG - Intergenic
1117581108 14:57152630-57152652 GTTCCTAATAGGCCACGGACTGG - Intergenic
1117706496 14:58475139-58475161 GTTCCTAACAGGCCACAGACTGG - Intronic
1117767789 14:59100892-59100914 GTTCCTAACAGTCCACAATCCGG + Intergenic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1118513798 14:66505644-66505666 GTTCCTAATAGGCCACAGATGGG - Intergenic
1118838049 14:69490469-69490491 GTTCCTAACAGGCCATGGACTGG + Intronic
1119062081 14:71485309-71485331 GTTCCCAAGAGGCCACAGACTGG - Intronic
1119121606 14:72084355-72084377 GTTCCTAACAGGCCACAGACTGG + Intronic
1119260378 14:73234789-73234811 GTTCCTAACAGGCCATGGACAGG + Intergenic
1119293721 14:73516662-73516684 GTTCCTAACAGGCCATGAACTGG - Intronic
1120141033 14:80929892-80929914 GTTCCTAACAGGCCACGGACTGG - Intronic
1120558218 14:85956693-85956715 GTTCCTAACAGGCTGCAGACTGG - Intergenic
1120594246 14:86414483-86414505 GTTCCAAACAGGGCCTAACCTGG + Intergenic
1120618755 14:86737319-86737341 ATTCCTAATAGGCCACAGACTGG - Intergenic
1120810924 14:88802721-88802743 GTTCCTAACAGGCCACAGATGGG - Intergenic
1120868643 14:89317750-89317772 GTTCCTAACAGGCCCCGAACTGG - Intronic
1120919593 14:89742909-89742931 GTTCCTAACAGGCCATGAACTGG + Intergenic
1120988580 14:90355218-90355240 GTTCCTAACAGGCCATGGACAGG + Intergenic
1121078121 14:91085928-91085950 GTTCCTAAGAGGCCACAAACTGG - Intronic
1121149180 14:91615124-91615146 GTTCCTAACAGTCCACAGACTGG - Intronic
1121170552 14:91850420-91850442 GTTCCTAATAGGCCACAGGCTGG - Intronic
1121432639 14:93898694-93898716 GTTCCTTACAGACCATAACAGGG + Intergenic
1121497076 14:94400205-94400227 GTTCCTAACAGGCCAAGGACCGG + Intergenic
1121500910 14:94436692-94436714 GTTCCTAACAGGCCACGGACTGG - Intergenic
1122190170 14:100036012-100036034 GTTCCTAACAGGCCACGAACTGG - Intronic
1122833632 14:104420037-104420059 GTTCCTAACAGGCCACGGACTGG - Intergenic
1122833696 14:104420661-104420683 GTTCCTAACAGGCCACGGACTGG - Intergenic
1123065020 14:105614265-105614287 GTTCCTAACAGGCCATGAACCGG - Intergenic
1123069214 14:105633700-105633722 GTTCCTAACAGGCCATGAACCGG - Intergenic
1123088314 14:105729492-105729514 GTTCCTAACAGGCCATGAACTGG - Intergenic
1202894242 14_KI270722v1_random:188910-188932 GTTCCTCACAGGCCACAGACTGG - Intergenic
1124096842 15:26656522-26656544 GTTCCTAACAGGCCACGGACTGG - Intronic
1124393103 15:29277657-29277679 GTTCCTAACAGGCCACGAACTGG + Intronic
1124808210 15:32907501-32907523 GTTCCTAACAGGCCATGGGCTGG + Intronic
1124864485 15:33475579-33475601 GTTCCCAACAGGCCATGAACTGG + Intronic
1124917823 15:33994091-33994113 GTTCCTAACAAGCCACAGACCGG - Intronic
1125249053 15:37678344-37678366 GTTCCTAACAGGCCACAGACTGG + Intergenic
1125375869 15:39028824-39028846 GTTCCTAACAGGCCACAGACCGG - Intergenic
1125643539 15:41251495-41251517 GTTCCTAACTGGCCACAGACTGG - Intronic
1125750204 15:42022768-42022790 GTTCCAAACAGGCCACGGACTGG + Intronic
1125860722 15:42997005-42997027 GTTCCCAACAGGCCATAGACTGG - Intronic
1126344383 15:47677144-47677166 GTTCCTAACAGGCTACAGACTGG + Intronic
1126457022 15:48874382-48874404 GTTCCTAACAGGCCACGGACTGG - Intronic
1126474762 15:49054144-49054166 GTTTCTAACAGGCCCCTAGCTGG - Intergenic
1126646884 15:50883604-50883626 GTTCCTAACAGGCCAGGGACCGG - Intergenic
1126661843 15:51040000-51040022 GTTCCTAACAGGCCACGGACCGG - Intergenic
1126721126 15:51581088-51581110 GTTCCTAACAGGCCATGGACTGG - Intronic
1126821658 15:52510488-52510510 GTTCCTAACAGGCCAGGGACTGG - Intronic
1126911512 15:53422007-53422029 GTTCCTAACAGGCCACAGACTGG - Intergenic
1127008562 15:54597236-54597258 GTTCCTAACAGGCCACAGACCGG + Intronic
1127233690 15:57024052-57024074 GTTCCTAATAGGCCACATATTGG + Intronic
1127320110 15:57835860-57835882 GTTCCTAGCAGGCCACAGATGGG + Intergenic
1127379066 15:58413363-58413385 GTTCCTAACAGGCCACACACTGG - Intronic
1127441836 15:59016742-59016764 GTTCCTAATAGGCCACAGATGGG - Intronic
1127809502 15:62551262-62551284 GTTCCTAACAGGGCACAGACTGG + Intronic
1127901055 15:63341294-63341316 GTTCCTAACAGGCCACAGACCGG - Intronic
1128118831 15:65131037-65131059 GTTCCTAACAGGCCATGGACTGG - Intronic
1128383445 15:67130362-67130384 GTTCCTAACAGGCCGCACACGGG - Intronic
1128934963 15:71738336-71738358 GTTCCTAACAGGCCATGGACTGG + Intronic
1129499462 15:76022119-76022141 GTTCCTAATAGGCCACAGTCTGG + Intronic
1129595258 15:76958881-76958903 GTTCCTAACAGGCCATGAACCGG + Intergenic
1129735246 15:77957283-77957305 GTTCCTAACAGGTCACTGACTGG + Intergenic
1129880404 15:79002990-79003012 GATCCGAACAGGCCACATCTTGG - Intronic
1129985080 15:79911908-79911930 GTTCCTAACAGGCCGCTGACTGG - Intronic
1130918894 15:88327591-88327613 GTTCCCAACAGGCCACGGACTGG + Intergenic
1131016734 15:89063934-89063956 GTTCTTAACAGGCCACGGACAGG + Intergenic
1131132392 15:89908630-89908652 GTTCCTAACAGGGCAAGCCCAGG + Intronic
1131407263 15:92175585-92175607 GTTCTTAAAAGGCCACCAACGGG - Intergenic
1131565687 15:93483431-93483453 GTTCCAAACAGGCCACGGACTGG - Intergenic
1131714626 15:95094849-95094871 GTTCCTAACAGGCCAGGGACTGG + Intergenic
1131810581 15:96169048-96169070 GTTCCTAACAGGCCACAGATTGG - Intergenic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1132076487 15:98825419-98825441 GTTCCTAACAGGCCATGGACCGG - Intronic
1133119986 16:3600304-3600326 GTTCCTAACAGGCCACAGACCGG + Intronic
1133586687 16:7202539-7202561 ATTCCTAACAGGCCATACACCGG - Intronic
1133660343 16:7910353-7910375 GTTCCTAACAGGCCACAGCTGGG + Intergenic
1133863756 16:9621815-9621837 GTTCCTAACAGGCCACGGATTGG + Intergenic
1133967958 16:10545364-10545386 GTTCCTAACAGGCTACAGACAGG - Intronic
1134689244 16:16180218-16180240 GTTCCTAACAGGCCACAGACTGG + Intronic
1134901522 16:17942362-17942384 GCTCCTGACAGGGCACAAACTGG + Intergenic
1135127657 16:19824459-19824481 GTTCCTAACAGGCCATGGACCGG + Intronic
1135284562 16:21182214-21182236 GTTCCTAACAGGCCAAGGACCGG - Intergenic
1135300329 16:21321254-21321276 GTTCCTAACAGGCCATGGACCGG + Intergenic
1135798680 16:25472176-25472198 GTTCCTAACAGGCCATGGACTGG - Intergenic
1136060940 16:27726011-27726033 GTTCCTAACAGGCCACAGACTGG - Intronic
1137836641 16:51598448-51598470 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1138109561 16:54312778-54312800 GTTCCTAACAGGCCATGGACTGG + Intergenic
1138313697 16:56050145-56050167 GTTCCTAACAGGCCACAAACCGG - Intergenic
1138694207 16:58796443-58796465 CTTCCTAACAGGTCACAGACTGG - Intergenic
1138774884 16:59709180-59709202 GCTCCTAACAGGCCGCGAACTGG + Intergenic
1139120443 16:64009788-64009810 GTTTTTAACAGGCCACAGACTGG + Intergenic
1139305861 16:65985929-65985951 GTTCCTAACAGGCCACAGACTGG - Intergenic
1139997848 16:70997266-70997288 GTTCCTAACAGGCCACAAACTGG + Intronic
1140163322 16:72522565-72522587 GTTCCTAACAGGTCACAGACTGG + Intergenic
1140241435 16:73204618-73204640 GTTCCTAACAGGCCATGGACTGG + Intergenic
1140338699 16:74136459-74136481 GTTCCTAACAAGCCACAGACTGG + Intergenic
1140548366 16:75834956-75834978 ATTCCTAACAGGCCACTGGCTGG + Intergenic
1140672624 16:77293898-77293920 GTTCCTTACAGACCACAAACAGG + Intronic
1140688050 16:77452522-77452544 GTTCCTAACAGATCACAGACAGG + Intergenic
1140920337 16:79531792-79531814 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1141043642 16:80694307-80694329 GTTCCTAACAGGCCACGGCCTGG + Intronic
1141107109 16:81242766-81242788 GTTCCTAACAGGCTACAGACTGG - Intronic
1141193298 16:81840734-81840756 ATTCCTAACGGGCCACAGACAGG + Intronic
1141216089 16:82025176-82025198 GTTCCTAACAGGCCACAGACTGG + Intergenic
1141324398 16:83042186-83042208 GTTTCTAACAGGCCACGGACTGG - Intronic
1141772550 16:86099593-86099615 GTTCCCAACAGGCCACCTACTGG + Intergenic
1141870662 16:86783384-86783406 GTTCCTAACAGGCTACAGATTGG + Intergenic
1142542101 17:667760-667782 GTTCCCAACAGGCCACGGACTGG - Intronic
1142618132 17:1148499-1148521 GTTCCCAACAGGCCACGGACTGG - Intronic
1143796618 17:9342268-9342290 GTTCCTAAAAGGCCACAGACCGG + Intronic
1143812289 17:9481684-9481706 GTTCCTAACAGGCCATGGACTGG - Intronic
1144310858 17:14013312-14013334 GTTCCCCACAGGCCACAAACTGG - Intergenic
1144450181 17:15370608-15370630 GTTCCTAACAGGCTGCAGACCGG + Intergenic
1144584485 17:16479907-16479929 CTTCCTAACAGGTCACAGACTGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145009694 17:19360884-19360906 GTTCCTAACAGGCCACGGACTGG - Intronic
1145099193 17:20059462-20059484 GTTCCTAACAGGCTATGAACTGG + Intronic
1145191673 17:20846457-20846479 GTTCCTAACAGGCCATGAGCAGG - Intronic
1145315830 17:21733039-21733061 GTTCCTAACAAGCCACAGAATGG + Intergenic
1146255103 17:31387682-31387704 GTTCCTAACAGGCCATGAACTGG - Intergenic
1146689365 17:34862534-34862556 GTTCCTAACAGGCAACAGACTGG - Intergenic
1146738088 17:35256860-35256882 GTTCCTAACAGGCCACAGTCAGG - Intronic
1147505871 17:41016808-41016830 GTTCCTAACAGGCCAGGGACAGG + Intronic
1148333432 17:46825648-46825670 GTTCCTTGCAGGCCAAAACCTGG - Intronic
1149025920 17:52027331-52027353 GTTCCTAACAGGCCTCTGACTGG + Intronic
1149440287 17:56668053-56668075 GTTCCTAACAGGCCACAGACTGG - Intergenic
1149588256 17:57808099-57808121 GTTCCTAACAGGCCACTGACTGG - Intergenic
1149703146 17:58672229-58672251 GTTCCTAACAGGCCACCAACTGG + Intronic
1150181387 17:63124687-63124709 GTTCCTAATAGGCCACGGACTGG - Intronic
1150517109 17:65825426-65825448 GTTCCTAACAGGCCACAGACAGG + Intronic
1150594204 17:66590057-66590079 GTTCCTAACAGGCCATGGACAGG + Intronic
1150976058 17:70088443-70088465 GTTCCTAACAGGCCATGGACTGG + Intronic
1151331622 17:73413048-73413070 GTTCCTAACAGACCACAGACTGG - Intronic
1151413409 17:73946133-73946155 GTTCCTAACAGGCCACAGACTGG - Intergenic
1151573687 17:74940487-74940509 GTTCCTAACAGGCCATGGACTGG - Intronic
1151984050 17:77530629-77530651 GTTCCTAAAGGGCCACAGACCGG + Intergenic
1152163992 17:78689602-78689624 GCTCGTAACAGGCCACAGACTGG + Intronic
1152316382 17:79583044-79583066 GTTCCTAAGGGGCCACATCAAGG + Intergenic
1152414518 17:80150607-80150629 GTTCCTAACAGGCCACAGACAGG - Intergenic
1152621106 17:81365333-81365355 GTTCCTAACAGGACACCAACAGG + Intergenic
1152945343 17:83194887-83194909 GTTCCTAACAGACCACAGCCTGG + Intergenic
1153013449 18:562061-562083 GTTCCTGACAGGCCACGGACAGG - Intergenic
1153205574 18:2696290-2696312 GTTCCTAAAAGGCCACAGATGGG - Intronic
1153519319 18:5937266-5937288 GTTCCTAATAGGCCACAAACTGG - Intergenic
1153533857 18:6079121-6079143 GTTCCTAACAGGCTACAGACCGG + Intronic
1153660162 18:7318789-7318811 GCTCCTAAAAGGCCAAGACCTGG - Intergenic
1153955358 18:10091318-10091340 GTTCCTAACAGGCCACGGAGTGG - Intergenic
1154345202 18:13537597-13537619 GTTCCTAACAGTCCATGAACCGG + Intronic
1154935561 18:21052553-21052575 GTTCCTAATAGGCCATGAACCGG - Intronic
1155401827 18:25447798-25447820 GTTCCTAACAGGCCACGGACTGG - Intergenic
1155409924 18:25532702-25532724 GTTACTAACAGGCTTCAACTTGG + Intergenic
1155612519 18:27682875-27682897 GTTCCTAACAAGCCACAGACTGG + Intergenic
1155690701 18:28618828-28618850 GCTCCTAACAGGCCAGAGACAGG + Intergenic
1155759638 18:29549619-29549641 GTTCCTAACAGGCCACAGACTGG - Intergenic
1155908328 18:31479022-31479044 GTTCCTAACAGGCCACAGACAGG + Intergenic
1155914180 18:31539755-31539777 GTTCCTAACAGGCCATGGACAGG - Intronic
1156276179 18:35584877-35584899 GTTTCTAACAGGCCACAGACTGG + Intronic
1157209947 18:45733759-45733781 GTTCCCAACAGGCCACAGACAGG - Intronic
1157540160 18:48495896-48495918 GTTTTTAACAGGCCACAGACTGG - Intergenic
1157691645 18:49687291-49687313 GTTTCTAACAGGCCACAGACCGG + Intergenic
1158094452 18:53754980-53755002 GTTCATAACAGGCAAGAATCAGG - Intergenic
1158285302 18:55874139-55874161 GTTCCTAACGGGCCACAGACAGG + Intergenic
1158441181 18:57475568-57475590 GTTCCTAGAAGGCAGCAACCAGG - Intronic
1158595997 18:58816555-58816577 GTTCCTAACAGGCCACAGACCGG + Intergenic
1158810080 18:61021759-61021781 GTTCCTAACAGGCCACCAGCAGG - Intergenic
1158862913 18:61610566-61610588 GTTTCTAACAGGCCACAGACTGG + Intergenic
1158865130 18:61631244-61631266 GTTCCTAACAGGCCACCTACTGG + Intergenic
1158909524 18:62046329-62046351 GTTCCTAACAGGCCACAGACTGG - Intronic
1158910507 18:62056721-62056743 GTTCCTAACAGGCCATGAACTGG - Intronic
1159558360 18:69968272-69968294 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1160223236 18:76992428-76992450 GTTTCTAACAGGCCACAGAGCGG + Intronic
1160606793 18:80057696-80057718 GTTCCTAACAGGCCACAGATGGG - Intronic
1160609799 18:80076084-80076106 GTTCCTAACAGGCCATGGACGGG - Intronic
1160665907 19:328063-328085 GAGCCTCACTGGCCACAACCAGG + Intronic
1161976336 19:7609966-7609988 GTTCCTGACAGGCCACGCCCCGG + Intronic
1162037457 19:7949437-7949459 GTTCCTAACAGGCCACAGACAGG + Intergenic
1162655581 19:12126649-12126671 GTTCCTAACAGGCCATGGACAGG + Intronic
1162684490 19:12370449-12370471 GCTCCTAACAGGCCACAGTCTGG + Intergenic
1162833293 19:13300078-13300100 GTTCCTAATAGGCCTCGGCCTGG + Intronic
1163372772 19:16911141-16911163 CTTCCTAACAGGCCACCAACCGG - Intronic
1163616835 19:18334152-18334174 GTTCCTAACAGGCCACAGACTGG - Intergenic
1164155308 19:22592255-22592277 GTTCCTAATAGGCCATAGACAGG + Intergenic
1164323729 19:24174165-24174187 GTTTATAACAGGCCACAGACTGG + Intergenic
1164686018 19:30167351-30167373 CTTCCTAACAGGGCCCAGCCCGG - Intergenic
1165054440 19:33165203-33165225 TTTCCTAACAGGCCACAGACTGG + Intronic
1165274650 19:34737948-34737970 ATTTCTAACAGGCCACAGACTGG + Intronic
1165479162 19:36051800-36051822 ATTCCTAACAGGCCATAGACTGG - Intronic
1165779220 19:38422456-38422478 GTTCCTAACAGGCCACGGACTGG - Intronic
1166017194 19:39991234-39991256 GTTCCTAACAGGCCATGGACTGG + Intronic
1166391956 19:42413323-42413345 CTTCCTAAAGGGCCACACCCCGG - Intronic
1166526104 19:43510812-43510834 GTTCCTAACAGACCACGGACCGG - Intronic
1166582591 19:43915541-43915563 GATCCTAACAGGCCACGGACTGG - Intronic
1167034941 19:46989533-46989555 CTTCCTTTCAGACCACAACCTGG + Exonic
1167223207 19:48217217-48217239 GTTTCTAACGGGCCACAGACCGG + Intronic
1167802436 19:51753212-51753234 CTTCCTAACAGGCCACAGACCGG - Intronic
1167986771 19:53325027-53325049 GTTCCTAACAGGCCATAGACTGG - Intergenic
1167998610 19:53426544-53426566 GTTCCTAACAGGCCACCCATGGG - Intronic
1168008732 19:53512655-53512677 GTTCCTAACAGGCCACCCATGGG - Intergenic
1168384640 19:55953000-55953022 GTTCCTAACAGGCCACAGACTGG - Intronic
1168455312 19:56502941-56502963 GTTTCTAACAGGTCACAGACTGG - Intergenic
1168560686 19:57380270-57380292 GTTCCTGACAGGCCACGGACTGG + Intronic
1168568722 19:57446132-57446154 GTTCCTAACAGGCCACAGACTGG - Intronic
925029588 2:639183-639205 GTTCCTAACAGGCCACAGGCTGG + Intergenic
925103829 2:1272434-1272456 GTTCCTAACAGGCCACAGACTGG + Intronic
925180366 2:1813489-1813511 GTTCCTCACAGGCCACGGCCGGG - Intronic
925221896 2:2148473-2148495 GTTCCTAACAGGCCACGGATAGG + Intronic
925530476 2:4855338-4855360 GTTCCTAACAGGCCACGGACAGG - Intergenic
925825251 2:7841971-7841993 GTTCCTAACAGGCTACAGACTGG + Intergenic
925851762 2:8088633-8088655 GTTCATATCAGGCCTGAACCTGG - Intergenic
925926486 2:8674925-8674947 ATTCCTAACAGGTCACAGACCGG - Intergenic
926562206 2:14430151-14430173 GTTCCTAACAGGCCAAAGACTGG - Intergenic
926669006 2:15558273-15558295 TTTCCTAACAGACCACAGACTGG + Intronic
926701501 2:15807196-15807218 GTTCCTAACAGGCCCCAAATCGG - Intergenic
926963060 2:18379981-18380003 GTTCCTAACAGGCCACGCACTGG - Intergenic
927204461 2:20598511-20598533 GTTCCTAACAGGCCAGGGACCGG + Intronic
927228034 2:20789670-20789692 GTTCCTGACAGGCCACAGACAGG - Intronic
927244241 2:20944014-20944036 GTTTCTAACAGGCCACCGACTGG + Intergenic
927507863 2:23626353-23626375 GTTCCTAACAGGCCACAGGCTGG + Intronic
927765529 2:25803830-25803852 GTTCCTAACGGGCCACAGACTGG + Intronic
927803956 2:26128351-26128373 GTTCTTAACAGGCCACGGACCGG + Intronic
927817622 2:26233187-26233209 GTTCCTAACAGGCTATGGCCTGG + Intronic
928711990 2:34017655-34017677 GTTCCTAACAGGCCACAGACTGG + Intergenic
929090095 2:38207553-38207575 GTTCCTAATAGGCTACAAACTGG - Intergenic
929264114 2:39899413-39899435 GTTCCTAACCGGCCACAAATCGG - Intergenic
930222667 2:48761063-48761085 ATTCCTAACAGGCCAGGCCCTGG + Intronic
930842685 2:55864886-55864908 GTTCCTAACAGGCCATGGACAGG + Intergenic
930948390 2:57105837-57105859 GTTCCTAGCAGGCCACAGACAGG - Intergenic
931011142 2:57915758-57915780 GTTCCTAACAGGCCACAAACCGG - Intronic
931094818 2:58927189-58927211 GTTCCTAACAGGCCATGGACAGG + Intergenic
931298293 2:60951718-60951740 ATTCCTAACAGGTCACCAGCTGG + Intronic
931367617 2:61632676-61632698 GTTCCTAACAGGCTACTCACGGG - Intergenic
931489016 2:62724715-62724737 GTTCCCAACAGGCCATAGACTGG - Intronic
931550997 2:63446204-63446226 GTTGCTAACAGGCCACAGATGGG - Intronic
932054344 2:68429607-68429629 GTTCCTAACAGGCCATAGACTGG - Intergenic
932959950 2:76402015-76402037 GTTCCTAACAAGCCACGGACTGG - Intergenic
933072106 2:77871717-77871739 GTTCCTAACAGGCCATGGACTGG + Intergenic
933224166 2:79726357-79726379 GCTCCTAACAGGCCACGGACAGG - Intronic
933313008 2:80684040-80684062 GTTCCTAACAGGCCATGGACTGG + Intergenic
933739631 2:85523358-85523380 GTTCCTAACAGGGCACAGACTGG + Intergenic
933888218 2:86740030-86740052 GTTCCTAACAGGCCACAGAGGGG - Intronic
933921960 2:87056676-87056698 GTTCCTAACAGGCCACAGAGGGG + Intergenic
934876097 2:97922296-97922318 GTTCCTAACAGGCCACAGACCGG + Intronic
934984745 2:98876372-98876394 CTTCCTAACAGGCCACGGTCTGG - Intronic
935002372 2:99031651-99031673 GTTCCTAACAGACCACAGACTGG - Intronic
935228198 2:101072779-101072801 GTTCCTAACAGGCCACAAATTGG + Intronic
935433094 2:102999155-102999177 GTTCCCAACAGGCCACGGACTGG - Intergenic
935725672 2:106021819-106021841 GTTCCTAACAGGCCACAGATTGG - Intergenic
935804305 2:106730989-106731011 GTTCCTAATAGGCCACAGACTGG - Intergenic
935870999 2:107449679-107449701 GTTTCTAACAGGCCACAGAAGGG + Intergenic
935884575 2:107602973-107602995 GTTCATAACAGGTCACAAACTGG - Intergenic
936034506 2:109100201-109100223 GTTCCTAACAGGCCACAGACTGG - Intergenic
936042358 2:109159612-109159634 GTTCCTAACAGGGCACAGACTGG - Intronic
936228930 2:110682464-110682486 GTTCCTAACAGGCCATGAACAGG + Intergenic
936511919 2:113155433-113155455 GGTCCTAACAGGCCATGAACAGG - Intergenic
936755943 2:115712413-115712435 GTTCTTAACAGGCCACAGACTGG + Intronic
937455292 2:122036095-122036117 GTTCCTAACAGGACACAGATTGG - Intergenic
937836716 2:126478610-126478632 GTTCCTAACAGGCCATGGACTGG - Intergenic
937896869 2:126983326-126983348 GTTCCTTGCAGGCCACATTCAGG + Intergenic
938684188 2:133720971-133720993 ATTCCTAACAAGCCACAGACTGG + Intergenic
938685083 2:133730276-133730298 GTTCTTAGCAGAACACAACCAGG + Intergenic
938740820 2:134230335-134230357 GTTCCTAACAGGCCAAGGACTGG + Intronic
938963142 2:136361051-136361073 GTTCCTAACAGGTCACGAACCGG + Intergenic
939370398 2:141292005-141292027 GTTCCTAACAGGCCACGGACTGG - Intronic
939658145 2:144853080-144853102 CTTCCTACCAGGCCACAGACTGG - Intergenic
940293786 2:152101683-152101705 GTTCCTAACAGGCCACAGACTGG - Intergenic
940350642 2:152682879-152682901 GTTCCCAACAGGCCACGGACTGG - Intronic
940428019 2:153552988-153553010 CTTCCTAACAGACCACAGACTGG + Intergenic
940610012 2:155978452-155978474 CTTCCTAACAGGCCATGAACTGG - Intergenic
940986821 2:160059248-160059270 GTTCCTAACAGGCCACAAACTGG + Intronic
941002731 2:160218729-160218751 GTTGCTAACAGGCCACAGACTGG - Intronic
941075966 2:161007128-161007150 GTTCCTAACAGGCCACGGACTGG + Intergenic
941403795 2:165063626-165063648 GTTCCTAACAGGTCACTGACTGG + Intergenic
941676238 2:168346098-168346120 ATTCCTAACAGGCCACAGACTGG - Intergenic
942104905 2:172624293-172624315 GTTCCTTACAGGCCACAGACTGG - Intergenic
942254706 2:174085268-174085290 ATTCCTAACAGGCCATGGCCTGG - Intronic
942338816 2:174921147-174921169 GTTCCTAACAGGCCACAGAGTGG + Intronic
942340069 2:174934497-174934519 GTTCCTAACAGGCCACAAGACGG + Intronic
942477623 2:176344659-176344681 GTTCCTAACAGGCCACGGACTGG - Intergenic
942944800 2:181660290-181660312 GTTCCAAACAGGCCACAGACAGG + Intronic
943058928 2:183017615-183017637 GTTCCTAACAGGCCACGGACTGG + Intronic
943086525 2:183318383-183318405 GTTCCTAACAGCCCGCACACTGG - Intergenic
943294357 2:186117834-186117856 GTTCCTAATAGGCCATAGACGGG + Intergenic
943618453 2:190120069-190120091 GTTCCTAACAGGCCACGGACTGG - Intronic
943648814 2:190434842-190434864 ATTCCTAACAGGCCACAGAGTGG - Intronic
943742987 2:191431275-191431297 GTTCCTAACAGGCCATAGACCGG - Intergenic
943745201 2:191454919-191454941 GTTCCTAACAGGCCATGGACTGG + Intergenic
944237955 2:197457204-197457226 GTTCCTAACAGGCCACGGACAGG + Intronic
944311606 2:198239912-198239934 GTTCCTAACAGGCCACAGACTGG - Intronic
944313325 2:198259281-198259303 GTTCCTAAGAGGCCATGAACTGG + Intronic
944318716 2:198311271-198311293 GTTCCTAACTGGCCACACACTGG + Intronic
944612521 2:201426100-201426122 GTTCCTGACAGGCCACAGATGGG - Intronic
944775877 2:202963943-202963965 GTTCCTATCAGGCTACAGACTGG + Intronic
944777461 2:202981370-202981392 GTTCCTAACAAGGCACAGACTGG + Intronic
944870979 2:203911554-203911576 GTTCCTAATAGGCCTCAGACTGG + Intergenic
944896195 2:204167782-204167804 GTTCCTAACAGGCCACAGACTGG - Intergenic
945027310 2:205631416-205631438 GTTCCTAACAGGCCACAGACCGG + Intergenic
945027415 2:205632317-205632339 GTTCTCAACAGGCCACAGACGGG - Intergenic
945149817 2:206778706-206778728 GTTCCTAACAGGCCACGGACTGG - Intronic
945157063 2:206850030-206850052 GTTTCCAACAGGCCACAGACTGG + Intergenic
945157323 2:206853187-206853209 GTTCCTAACAAGCCACTGACGGG - Intergenic
945308467 2:208283072-208283094 GTTCCTAACAGGCTACGGACGGG + Intronic
945327653 2:208501446-208501468 GTTCCTAACAGGCCATGAACCGG + Intronic
945526592 2:210895383-210895405 GTTCCTAACAGGCCACAGACTGG + Intergenic
945635236 2:212340758-212340780 GTTCCTAACAGACCATAGACTGG + Intronic
946150408 2:217762405-217762427 GTTCCTAACAGGCCATGGGCTGG + Intergenic
946436925 2:219663309-219663331 GTTCCCAACAGGCCACGGACTGG + Intergenic
946655947 2:221947175-221947197 TTTCCTAAGAGGCCACTACAGGG - Intergenic
946779309 2:223176567-223176589 GTTCCTAACAGGCCACAGACCGG - Intronic
946806397 2:223475016-223475038 GTTCTTAGCAGGCCACAGACTGG - Intergenic
947197787 2:227585926-227585948 TTTCAGAAGAGGCCACAACCAGG - Intergenic
947218727 2:227772514-227772536 GTTCCCAGCAGGCCACAGACTGG - Intergenic
947248867 2:228079334-228079356 GTTCCTAACAGGTCACCAATTGG + Intronic
947561731 2:231160029-231160051 GTTCCTAACAGGCCATGGACAGG + Intronic
947929898 2:233955766-233955788 GTTCCTAACAGGCCATGGACCGG - Intronic
948165358 2:235857107-235857129 GTTCCTAACAGGCCACAGACTGG - Intronic
948250134 2:236520901-236520923 GTTCCTAACAGGCCACGGACCGG + Intergenic
948330189 2:237158423-237158445 GTTCCTAACAGGCCACAGACTGG + Intergenic
948386076 2:237581945-237581967 TGTCCTAACAGGCCACAGCAGGG - Intronic
948394937 2:237638459-237638481 GTTCCTAACAGGCCATGGACTGG + Intronic
948420370 2:237856334-237856356 GTTCCTAACAGGCCATGATCTGG + Intergenic
948516337 2:238506066-238506088 GTTCCTAACAGGCCACAGTCGGG + Intergenic
948535741 2:238645243-238645265 GTTCCTAACAGGCCACAGACAGG - Intergenic
948654740 2:239469619-239469641 GTTCCTAACAGGCCACAGACTGG + Intergenic
948690257 2:239697710-239697732 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1168784036 20:521992-522014 GTTCCTAACAGGCCATGAACTGG - Intronic
1169166724 20:3430517-3430539 TTTCCTAACAGGCCACAGACTGG + Intergenic
1169322014 20:4640763-4640785 GTTCCTAACAGGCCACAGACTGG - Intergenic
1169407199 20:5331749-5331771 GTTCATAACAGACCACAGACTGG + Intergenic
1169527422 20:6445176-6445198 GTTCTTAACAGGCCACGGACTGG - Intergenic
1169550365 20:6695936-6695958 GTTCCTAACAGACCATAGACTGG + Intergenic
1169640036 20:7741479-7741501 GTTCCTAACAGGCCATGGACTGG + Intergenic
1169946675 20:10996489-10996511 GTTCCTAACAGGCCACAGACTGG - Intergenic
1170018832 20:11813288-11813310 GTTCCTAACAGGCCTCAGACCGG + Intergenic
1170135538 20:13069645-13069667 GTTCCTAACAGGCCACAGACTGG + Intronic
1170195875 20:13689010-13689032 GTTCCTAACAGGCCAGGGACTGG - Intergenic
1170684427 20:18556214-18556236 GTTCCTAACAGGCCAAGGACTGG + Intronic
1171508646 20:25661122-25661144 GTTCCTAACAGGCCATGAACTGG + Intergenic
1172124584 20:32617859-32617881 GTCCCTGACAGGCCTCAGCCTGG + Intergenic
1172239086 20:33400208-33400230 GTTCCTCACAGGCCACAGACAGG + Intronic
1172622004 20:36323931-36323953 GTTCCTAACAGGCCACAGACTGG + Intronic
1172678514 20:36693521-36693543 GTTCCTAAGAGGGCACAGACTGG - Intronic
1172757124 20:37293551-37293573 GTTCCTAACAGGCCATGGACTGG + Intronic
1172850019 20:37954900-37954922 GTTCCTAACAGGTCACAAACTGG + Intergenic
1173320809 20:41985316-41985338 CTTCCTAACAGGCCACAGACTGG - Intergenic
1173477124 20:43367989-43368011 GTTCCTAACAGGCCATGGACCGG - Intergenic
1173546475 20:43902023-43902045 GTTCCTAACAGGCTACAGACCGG - Intergenic
1173570585 20:44073174-44073196 GTTCCTGACAGGCCACAGACTGG - Intergenic
1173725550 20:45294749-45294771 GTTCCTAACAGGCCATGGGCTGG - Intronic
1173833510 20:46109161-46109183 GCTCCTAACAGGCCACGGACTGG - Intergenic
1174064292 20:47853499-47853521 GCTCCTAACAGTCCACAAATTGG + Intergenic
1174144395 20:48440971-48440993 GTTCCTAACAGGCCATGGACTGG - Intergenic
1174365142 20:50052127-50052149 GTTCCTAACAGGCCACGAATGGG + Intergenic
1174427863 20:50445893-50445915 GTTCCTAATAGGCCACGGACTGG - Intergenic
1174633701 20:51980426-51980448 GTTCCTAACAGGCCATGGACTGG - Intergenic
1174866600 20:54142284-54142306 GTTCCTTACAGGCCACAGACTGG + Intergenic
1174886327 20:54339332-54339354 GTTCCTAACAGGCCATGCACTGG + Intergenic
1174986666 20:55461621-55461643 GTTCCTAACAGGCCACAAACTGG - Intergenic
1175203610 20:57294248-57294270 ATTCCTAACAGGCCACAGACCGG + Intergenic
1175651624 20:60729666-60729688 ATTCCTAACAGGCCTCAGACCGG - Intergenic
1175805866 20:61829104-61829126 GTTCCTAACAGGCCACAGACCGG + Intronic
1176714122 21:10335255-10335277 GTTCCTAACAGGACACGAACCGG + Intergenic
1177417161 21:20808760-20808782 GTTCCTAACAGGCCACAGACCGG - Intergenic
1177832215 21:26151810-26151832 GCTCCTAACACGCCACAGACCGG + Intronic
1178148742 21:29769661-29769683 GTTCCTAACAGGCCATGGACCGG + Intronic
1178296268 21:31412957-31412979 GTTCCTAACAGACCATAGACAGG + Intronic
1178297343 21:31421385-31421407 GCTCCTAACAGGCCATAGACTGG - Intronic
1178306725 21:31497088-31497110 GTTCCTAACAGGCCATTGACCGG + Intronic
1178319723 21:31596157-31596179 GTTCCTAACAGGCCACAGAACGG - Intergenic
1178325298 21:31640946-31640968 GTTCCTAGCAGTCCACAGACTGG + Intergenic
1178330531 21:31686646-31686668 TTTCCTAACAGGCCATAGACTGG - Intronic
1178380605 21:32104438-32104460 GTTCATAACAGGCCACGGACAGG - Intergenic
1178458336 21:32776855-32776877 GTTCCTAACAGGCCACTGACTGG - Intergenic
1178635157 21:34296119-34296141 GTTCCTAATAGGCCACGCACTGG - Intergenic
1178844752 21:36165538-36165560 GTTCCTAATAGGCCACGGACTGG - Intronic
1179057086 21:37946181-37946203 GTTCCTAACAGGCCACAGAGCGG - Intergenic
1179074452 21:38106935-38106957 GTTCCTAACAGGCCAGGGACTGG - Intronic
1179427024 21:41289670-41289692 GTTCCTAATAGACCACAGACCGG + Intergenic
1180100778 21:45584005-45584027 GTTCCTAACAGGCCACAGACTGG + Intergenic
1180452686 22:15481502-15481524 GTTCCTAACAGGCCATTAATGGG + Intergenic
1180761184 22:18209149-18209171 ATTCCTAACAGGACACGAACCGG + Intergenic
1180774483 22:18415470-18415492 GTTCCTAACAGGACACGAACCGG - Intergenic
1180807636 22:18726287-18726309 GTTCCTAACAGGACACGAACCGG - Intergenic
1181070595 22:20334478-20334500 GTTCCTAACAGGACACGAACCGG - Intergenic
1181193580 22:21162420-21162442 GTTCCTAACAGGACACGAACCGG - Intergenic
1181215863 22:21330178-21330200 GTTCCTAACAGGACACGAACCGG + Intergenic
1181567343 22:23747210-23747232 GTTCCTAACAGGCCACAGACTGG - Intronic
1181624109 22:24111315-24111337 GTTCCTAACAGGCCACGGACTGG - Intronic
1182525891 22:30918899-30918921 GTTCCTAACAGGCCATGGACTGG - Intergenic
1182722574 22:32415267-32415289 GTTCCTAACAGGCCACAGACCGG + Intronic
1182879382 22:33720412-33720434 GTTCCTAATAGGCCACGGACTGG + Intronic
1183461323 22:37952736-37952758 GTTCCTAACAGGCCAGGGACTGG - Intronic
1183756586 22:39772335-39772357 GTTCCTAACAGGTCACAGACTGG + Intronic
1183850553 22:40583547-40583569 GTTCCTAACAGGCCATGGACTGG - Intronic
1184565737 22:45290677-45290699 GTTCCTAACAGGCCATGGACTGG - Intronic
1184623827 22:45705861-45705883 GTTCCTAACAGGCCATGGACAGG - Intronic
1184883472 22:47327255-47327277 GCTCCTAACAGGCCACGGACTGG + Intergenic
1185189505 22:49425551-49425573 GTTCCTAACTGGCCACCGACCGG + Intronic
1185304282 22:50104274-50104296 GTTTCTAACAGGCCACAGTCCGG + Intronic
949293665 3:2495524-2495546 GTTCCTAACAGGCCACAGACAGG - Intronic
949800406 3:7897773-7897795 GTTCCTAACAGGCCAGGATCTGG - Intergenic
950374815 3:12562575-12562597 GTTCCTAAAAGGCCATAGACTGG - Intronic
950992857 3:17459461-17459483 GTTCCTAACAGGCCACAGCCTGG + Intronic
951050640 3:18089414-18089436 GTTCCTAACAGGCCACGGACTGG - Intronic
951226601 3:20127980-20128002 GTCCCTAACAGGCCACGGACTGG + Intronic
951509994 3:23489718-23489740 CTTCCTAACAGGCCACGGACTGG + Intronic
951628149 3:24689472-24689494 GTTCCTAACAGGCCACAGACTGG - Intergenic
952114170 3:30159471-30159493 GGTGATAACAGGCCACAACAAGG - Intergenic
952170907 3:30806025-30806047 GTTCCTAACAGGCCATGAACCGG + Intronic
952351970 3:32548166-32548188 GTTCCTGACAGGCCATAGACTGG - Intronic
952365560 3:32671789-32671811 GTTCCTAACAGGCCATGGACTGG + Intergenic
952635390 3:35523051-35523073 GTTCTTAACAGGCCACGAAGTGG + Intergenic
952709992 3:36420426-36420448 GTTCCTAACAGGCTACAGACCGG - Intronic
952796272 3:37242176-37242198 GTTCCTAACAGGCCATGGGCTGG + Intergenic
953227451 3:41033672-41033694 GTTCCTAACAGGCCACAGATTGG + Intergenic
953580004 3:44145206-44145228 GTTCCCAACAGGCCACGGACTGG - Intergenic
953849845 3:46457143-46457165 GTTCCTAACAGGCCATCAACCGG + Intronic
954476351 3:50749980-50750002 GTTCCTAACAGGCCACAGATTGG - Intronic
954628029 3:52033355-52033377 GTCCCTAAGAGGCCTCCACCTGG + Intergenic
954665022 3:52246973-52246995 GTTCCTGACAGGCCATTACTGGG + Intronic
954766048 3:52917596-52917618 ATTCCTAACAGGCCATAGACGGG - Intronic
954910610 3:54104197-54104219 GTTCCTAACAGGCCATGGACTGG - Intergenic
955022235 3:55132600-55132622 GTTCCTAACAGGCCACGGACTGG - Intergenic
955444214 3:58991811-58991833 GTTCCTAACAGGTCACCTACAGG + Intronic
955572838 3:60326565-60326587 GTTCCTAACAGGCCATGGACTGG + Intronic
955617581 3:60825504-60825526 GTCCCTAACAGGCCACAGACTGG - Intronic
955623901 3:60895960-60895982 GTTCCTAACAGGCCACAGACTGG - Intronic
955690114 3:61582510-61582532 GTTCCTATCAGGCTACGTCCTGG - Intronic
955718973 3:61862031-61862053 GTTCCTAACAGGCCAGGGACCGG - Intronic
955917933 3:63925335-63925357 TTTCCTAACAGGCCATAGGCGGG - Intronic
956213831 3:66827921-66827943 GTTCCTAACAGGCCACAGACCGG + Intergenic
956247980 3:67205273-67205295 GTTCCTAACAGGCCAGGGACTGG - Intergenic
956390590 3:68769059-68769081 GTTCCTAACAGGCCACAAACTGG - Intronic
956393496 3:68799785-68799807 GTTCCTAACAAGCCACAGACAGG - Intronic
956438693 3:69259379-69259401 GTTCCTAACAGGCCATGGACTGG + Intronic
956877514 3:73478193-73478215 GTTACTAACAGGCCACAGACTGG - Intronic
957150949 3:76485479-76485501 GTTCCTAACAGACCGCAAACTGG + Intronic
957623349 3:82624173-82624195 GTTCATAACAGGCCACAGACTGG - Intergenic
957724249 3:84044458-84044480 GTTCCTAACAGGCCACGGATGGG + Intergenic
957801554 3:85090645-85090667 GTTCCTAACAGGCCACTGACCGG - Intronic
957856205 3:85882035-85882057 GTTCCTAACAGACTGCAAACTGG + Intronic
958133304 3:89457315-89457337 GTTCGTAACAGGCCATGGCCTGG - Intronic
958261453 3:91386250-91386272 ATTCCTAACAGGCCACGGACTGG - Intergenic
958437829 3:94119565-94119587 GTTCCTAATAGGTCACAGACTGG + Intronic
958920228 3:100097007-100097029 GTTCCTAACAGGCCACAGAGTGG - Intronic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
959040846 3:101422004-101422026 GTTCCTAACAGACCACAGACTGG - Intronic
959294245 3:104514939-104514961 GTTCCTAATAGGCCACAGACAGG - Intergenic
959775910 3:110162784-110162806 GTTCCTAACAGGCCACAAACGGG - Intergenic
960537556 3:118830158-118830180 GTTTCTAACAGGCCACAGACTGG - Intergenic
960589078 3:119348017-119348039 GTTCCTAACAGGTCACGGACAGG - Intronic
960766448 3:121135745-121135767 GTTCCTAACAGGCCACAGACTGG + Intronic
960775411 3:121246070-121246092 GTTCCTAACAGGCCATGGACTGG - Intronic
960796280 3:121491820-121491842 GTTCCTAACAGGCCATGGACTGG - Intronic
960823423 3:121758147-121758169 GTTCCTAACAGGCCACGGACTGG + Intergenic
960976996 3:123185194-123185216 GTTTCTAACAGGCCACGGACGGG + Intronic
961031804 3:123612006-123612028 GTTCCTAACAGGCTACTTACCGG + Intronic
961195033 3:124994313-124994335 GTTCCTAACAGACCACAAACTGG + Intronic
961230511 3:125303360-125303382 GTTCCTAACAGGTCACGGCTTGG - Intronic
961253024 3:125522499-125522521 GTTCCTAGCAGACCACAGACTGG + Intergenic
961471323 3:127114955-127114977 CTTCCTGACAGGGCACATCCAGG - Intergenic
961727287 3:128939935-128939957 GTTCCTAACAGGCCAGAGACCGG + Intronic
962002132 3:131309073-131309095 GTTCCTAACAGGCCATGGACTGG + Intronic
962053215 3:131841398-131841420 GTTCCTAACAGGCCACAGACTGG - Intronic
962181886 3:133214703-133214725 GTTCCTAACAGGCCATGGACTGG - Intronic
962197620 3:133377735-133377757 GTTCCTAACAGGCCACAGACTGG - Intronic
962332203 3:134488050-134488072 GTTCCTAACAGGCCACGGACTGG - Intronic
962519652 3:136186423-136186445 GTTCCTAACAGGCCAAGGACCGG - Intronic
962857627 3:139363239-139363261 ATTCCTAACAGGCCACAGACTGG - Intronic
963118390 3:141753641-141753663 GTTCCTAACAGGCCAGGGACTGG + Intergenic
963147343 3:142007948-142007970 GCTCCTAACAGGCCACGGACTGG + Intronic
963356629 3:144216086-144216108 GTTCCTAACAGGCCAGGGACTGG + Intergenic
963536789 3:146539410-146539432 GTTCCTAACAGGCCACAGACTGG + Intronic
964008773 3:151864189-151864211 GTTCCTAAAAGGCAACAATAAGG + Intergenic
964378272 3:156071049-156071071 GTTCCTAACAGGCCAATGGCTGG - Intronic
964737466 3:159931380-159931402 GTTCCTAACAGGCCATGGACTGG + Intergenic
964876825 3:161376885-161376907 GTTCCTAACAGGCCACAGATAGG - Intergenic
964969707 3:162544293-162544315 GTTCCTAACAAGCCACAAAAAGG - Intergenic
965304847 3:167051555-167051577 GTTTCTAACAGGCCACTAACTGG - Intergenic
965639274 3:170815520-170815542 GTTCCTAACAGGCCACAGACTGG - Intronic
965769582 3:172167657-172167679 GTTCCTAACATGCCACAGACAGG - Intronic
965853705 3:173063007-173063029 GTTCCTAGCAGGCCACGATTGGG + Intronic
966358481 3:179107865-179107887 GTTCTTAACAGGCCACAGACTGG + Intergenic
966363394 3:179154238-179154260 GTTCCTAACAGGCCAGGGACAGG - Intronic
966563742 3:181352457-181352479 GTTCCTAACAGGCCATTGACTGG + Intergenic
967009868 3:185422803-185422825 GTTCCTAACAGGCCACAGACTGG - Intronic
967455147 3:189676739-189676761 GTTCCTAACAGGCCACAGATGGG - Intronic
967461982 3:189758321-189758343 GTTCCTAACAGGTCACATATTGG + Intronic
967786291 3:193500698-193500720 GTTCCTAACAGGCCATGGACAGG + Intronic
968055235 3:195686678-195686700 GTTCCTAACAGGCCATGGACTGG - Intergenic
968100667 3:195962534-195962556 GTTCCTAACAGGCCATGGACTGG + Intergenic
968331485 3:197874173-197874195 GTTCCTAACAGGCCACAGACTGG - Intronic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
969055559 4:4399978-4400000 GTTCCTAACAGGCCATGGACTGG + Intronic
969192229 4:5531425-5531447 GTTCCTAACAGGCCATAGGCCGG - Intergenic
969674033 4:8605121-8605143 GTTCCTCAGATGCCACATCCCGG - Intronic
970170021 4:13280171-13280193 GTTCCTAACAGGCCACAGACTGG - Intergenic
970388896 4:15587315-15587337 GTTCCTAACAGGCCACAGACTGG + Intronic
970620829 4:17816369-17816391 GTTCCTAACAGGCCACAGACTGG + Intronic
970633483 4:17980719-17980741 TTTCCTAACAGGCCACAGACTGG - Intronic
970760226 4:19476601-19476623 TTTCCTAACAGGGCACAGACAGG - Intergenic
970905466 4:21211331-21211353 GTTCCTAACAGGACACACACTGG - Intronic
970924422 4:21434517-21434539 GTTCCTAACAGGCCACAGAGTGG - Intronic
970929823 4:21496661-21496683 GTTCCTAACAGGCCATGGACTGG - Intronic
971032932 4:22660546-22660568 GTTCCTAACAGGCCACGGACTGG - Intergenic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
971364095 4:25962666-25962688 GTTCCCAACAGGCCACGGACTGG + Intergenic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
971755244 4:30699342-30699364 GTTCCTAACAGGCCACAAACTGG + Intergenic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
972187300 4:36545492-36545514 ATTCCTAATAGGCCACAGACTGG + Intergenic
972410029 4:38784260-38784282 GTTCCTAACAGGCCATGAACTGG - Intergenic
972419917 4:38877590-38877612 GTTCCTAACAGGCCATGGACTGG + Intronic
972556467 4:40186525-40186547 GTTCCTAACAGGCCACGGGTGGG + Intergenic
972622569 4:40762668-40762690 GTTCCTAACAGGCCACAGACAGG - Intronic
972660488 4:41111244-41111266 GTTCCTAACAGACCACAGAATGG + Intronic
972663389 4:41140605-41140627 GTTCCTAACAGGCCACAGACTGG - Intronic
972975690 4:44632916-44632938 GTTCCTAACAGGCCATGGGCAGG - Intronic
973145504 4:46820444-46820466 GTTCCTAACAGGCCATGGGCTGG + Intronic
973272126 4:48271901-48271923 GTTCCTAACAGACCTCAGACCGG + Intergenic
973275323 4:48301104-48301126 GTTCCTAACGGGCCATAGACTGG - Intergenic
973664558 4:53144894-53144916 GTTCCTAACAGGCCATGGACGGG - Intronic
973977866 4:56281114-56281136 GTTCCTAACAGGCCACACACCGG - Intronic
973990706 4:56404005-56404027 GTTCCTAACAAGCCACAGACTGG + Intronic
974009174 4:56592009-56592031 ATTCCTAACAGGCCACGGACCGG - Intronic
974347832 4:60704357-60704379 GTTCCTAACAGGCCACAGAGTGG - Intergenic
974897124 4:67953202-67953224 GTTCCTAACAGGCCATGGACAGG + Intronic
975039739 4:69731142-69731164 GTTCCTAACAGGCCACTGATTGG - Intronic
975070662 4:70133620-70133642 GTTCCTAACAGGCCAAGGACCGG - Intronic
975381672 4:73707563-73707585 GTTCCTAATAGGTCACACACTGG - Intergenic
975932088 4:79537466-79537488 GTTCCTAACAGGCCATGGACTGG - Intergenic
976111126 4:81674926-81674948 GTTCCTAACAGGCCAAGGACTGG + Intronic
976231918 4:82853076-82853098 GTTCCTAAGAGGCCACAGAAGGG + Intronic
976482864 4:85564846-85564868 GTTCCTAACTGGCCACAGACTGG + Intronic
976668155 4:87622484-87622506 GTTCCTAACAAGCCACAGACCGG + Intergenic
976674569 4:87690322-87690344 GTTTCTAATAGGCCACAGACTGG - Intergenic
976811064 4:89101801-89101823 GTTCCTGACAGGCCACCAACCGG - Intronic
976845390 4:89483396-89483418 GTTCGTAACAGTCCGCAAACTGG - Intergenic
977263868 4:94831699-94831721 GTTCCTTACAGGCCCCAGACTGG - Intronic
977388933 4:96382958-96382980 GTTCCTATTAGGCCACAGACTGG + Intergenic
977420606 4:96795202-96795224 GTTTCTAACAGGCCACAGACTGG + Intergenic
977429792 4:96916992-96917014 GTTCCTAACAGGCCTCAGAATGG + Intergenic
977699853 4:100008758-100008780 GTTCCTAGCAGGCCATAGACTGG + Intergenic
977810554 4:101350435-101350457 GTTCCTAATAGGCCACAGACTGG + Intergenic
978585416 4:110271375-110271397 GTTCCTAACAGGCCATGTACTGG - Intergenic
978623192 4:110655111-110655133 GTTCCTAACAGGCCACAGACTGG + Intergenic
978671007 4:111247126-111247148 GTTCCTAACAGGCCATGGACTGG - Intergenic
978989026 4:115054927-115054949 GTTGCTAACAGGCCACAGACTGG - Intronic
979464092 4:121016612-121016634 GTTCCTAACAGGCCACGGACCGG + Intergenic
979489510 4:121309019-121309041 GTTCCTAACAGGCCACAGACAGG - Intergenic
979790977 4:124780881-124780903 GTTCCTAACAGGCCAGGGACAGG - Intergenic
979852526 4:125591561-125591583 GTTCCTAACAGGTCACAGACTGG + Intergenic
979977766 4:127218257-127218279 GTTCCTAACAGGCCACGGACTGG - Intergenic
981000109 4:139821249-139821271 GTTCCTAACAGGCCACGGACTGG - Intronic
981591311 4:146365853-146365875 GTTCCTAACAGGCCACAGACTGG - Intronic
981691057 4:147509513-147509535 ATTCCTAACAGGCCATGAACTGG - Intronic
981728085 4:147868887-147868909 GTTCCTAACAGGCCATGGACCGG + Intronic
981734712 4:147936849-147936871 GTTCCTAATAGGCCACGGTCTGG - Intronic
981784490 4:148462139-148462161 GTTCCTAACAGGCCATGGACCGG - Intergenic
981980103 4:150781532-150781554 GTTTCTAACAGTCCACAGACTGG + Intronic
982023896 4:151232953-151232975 GTTCCTAACAGGCCATAGACTGG - Intronic
982049469 4:151486197-151486219 GTTCCTAACAGGCCAGAGACTGG + Intronic
982146833 4:152403792-152403814 GTTCCTAACAGGCCACAGACTGG + Intronic
982560032 4:156918480-156918502 GTTCCTAACAGGCCAAGGACTGG - Intronic
982713736 4:158784787-158784809 GTTCCTAACAGGCCATGGTCTGG + Intronic
983208006 4:164931479-164931501 GCTCTTAACAGGCCACCATCAGG + Intergenic
983274744 4:165603448-165603470 GTTCCTAACAGGCCATGGACTGG + Intergenic
983295058 4:165856783-165856805 GTTCCTAACAGGTCACAGACAGG + Intergenic
983631843 4:169857272-169857294 GTTCCTAACAGGCCATGGACTGG + Intergenic
983850249 4:172571089-172571111 GTTCCTAAAAGGCCACAGACTGG + Intronic
983869034 4:172803219-172803241 GTTCCTAACAGGCCACACATGGG - Intronic
984311666 4:178068385-178068407 GTTCCTAACAGGCCGTGAACTGG + Intergenic
984364970 4:178786530-178786552 GTTCCTAACAGGCCATGGACTGG + Intergenic
984376826 4:178942132-178942154 GTTCCTCACAGGCCACCAACCGG - Intergenic
984385295 4:179048035-179048057 GTTCCTAACAGGCCACAGACTGG + Intergenic
984466722 4:180109219-180109241 GTTCCTAACAGGCCAAGGACTGG - Intergenic
984736114 4:183109696-183109718 GTTCCTAACAGGCCATTGACCGG + Intronic
984772943 4:183454120-183454142 GTTCCTAACAGGCCACAGACTGG + Intergenic
985002545 4:185500309-185500331 GTTGCTAAAAGGCCACAGACTGG + Intergenic
985488753 5:166657-166679 GTTCCTAATAGGCCACAGATGGG + Intronic
985502405 5:257251-257273 GTTCCTAACAGGCCATGGACTGG - Intergenic
985684499 5:1274712-1274734 GTTCCTAACAGGCCCCAGACCGG + Intronic
986216453 5:5724051-5724073 ATTCCTAACAGGCCACGGACTGG + Intergenic
986320161 5:6624459-6624481 CTTCCAAACATGCCAAAACCTGG + Intronic
986837881 5:11661826-11661848 GTTCCTAACAGGCTACCAGCCGG - Intronic
987018829 5:13848875-13848897 GTTCCTAACAGGCCACAGACTGG + Intronic
987184939 5:15407696-15407718 GTTCCTAACAGGCCACAGACCGG + Intergenic
987230628 5:15890137-15890159 GTTCCTAACTGGCCACAGACCGG - Intronic
988013090 5:25515791-25515813 GTTCTCAACAGGCCACAGACTGG + Intergenic
988101692 5:26688045-26688067 GTTCCTAACAAGCCACGGACTGG + Intergenic
988347098 5:30051449-30051471 GTTCCTAACAGACCACTGACAGG - Intergenic
988390020 5:30615943-30615965 GTTCCTAATCGGCCACACACTGG - Intergenic
988392940 5:30659093-30659115 TTTCCTAACAGGCCATAGACTGG + Intergenic
988440676 5:31228822-31228844 GTTCCTAACAGGCTGCAGACTGG + Intronic
988813622 5:34808994-34809016 GATCCTAACAGGCCACAGACTGG + Intronic
989163605 5:38414039-38414061 CTTCCTAACAGGCCACAGACTGG + Intronic
989199849 5:38752444-38752466 GTTCAAACCAGACCACAACCGGG + Intergenic
989227543 5:39047460-39047482 GTTCCTAACAGGCCACGGACTGG + Intronic
989469182 5:41795298-41795320 GTTCCTAACAGGCCATGGACCGG + Intronic
989747500 5:44847441-44847463 GTTCCTAACAGGCCACTGACAGG + Intergenic
990009643 5:50981591-50981613 GTTCCTAACAGGCCATAGCCAGG - Intergenic
990118982 5:52425600-52425622 GTTCTTAACAGGCCACCGACTGG - Intergenic
990397219 5:55394660-55394682 GTTCTTAACAGGCCACAGACTGG + Intronic
990493188 5:56321645-56321667 GTTCCTAACAGGCCATGAACCGG + Intergenic
990762614 5:59146911-59146933 GTTCCTAACAGGCCATGGACCGG - Intronic
990972175 5:61520064-61520086 GTTCCTAACAGACCACAGACTGG + Intronic
991036848 5:62135925-62135947 GTTCCTAACAGGCCATAGACCGG + Intergenic
991332885 5:65511580-65511602 GTTCCTAACAGGCCATGGACTGG - Intergenic
991444650 5:66686062-66686084 CTTCCTAACAGGCCACGGACTGG + Intronic
991622476 5:68559205-68559227 GTTCGTAACAGGCCACAGACTGG - Intergenic
992033659 5:72749526-72749548 GTTCCTAACAAGCTACAAACAGG + Intergenic
992035681 5:72773281-72773303 GTTCTTAACAGGCCATGAACCGG - Intergenic
992307882 5:75462523-75462545 GTTCCTAACAGGCCATGGACTGG + Intronic
992485695 5:77192143-77192165 GTTCCCAACAGGCCACGGACTGG + Intergenic
992613520 5:78528268-78528290 GTTCCTAACAGGCCACAGACCGG - Intronic
992652736 5:78876765-78876787 GTTCCTAATAGGCCACAGATGGG - Intronic
993011870 5:82492298-82492320 CTTCCTAACAGGCCACAGACTGG - Intergenic
993157556 5:84244790-84244812 GTTCATAACAGGCCACGGACTGG - Intronic
993391343 5:87322197-87322219 GCTCCTAACAGGCCATAGACAGG - Intronic
993426047 5:87765245-87765267 GTTCCTAACAGGCCGCAGACTGG + Intergenic
993558141 5:89367389-89367411 TTTCCTAACAGGCCACAAACTGG + Intergenic
993855208 5:93065956-93065978 GTTCCTAACAGGCCACAGAGTGG - Intergenic
993894189 5:93511657-93511679 GTTCCTAACAGGTGACAGACTGG - Intergenic
993923064 5:93831168-93831190 GTTCCTAACAGGCCATGGACTGG + Intronic
993968547 5:94388300-94388322 GTTCCTAACAGGCCACCAACTGG + Intronic
994198028 5:96941329-96941351 ATTCCTAACAGGCCAGAGACTGG + Intronic
994516762 5:100782175-100782197 GTTCCTAACAGGCCACTGACTGG - Intergenic
994690966 5:103019047-103019069 GTTCCTAACAGGCCATGGCCCGG + Intronic
994841739 5:104932655-104932677 GTTCCTGACAAGCCACAGACTGG + Intergenic
995305308 5:110639943-110639965 ATTCCTAACAGACCACAGACTGG + Intronic
995522763 5:113026656-113026678 GTTACAAACAGACCACCACCAGG - Intronic
995627816 5:114098367-114098389 GTTCCTAACAGGCCACAGACTGG - Intergenic
995860521 5:116635767-116635789 ATTCCTAACAGGCTACAGACTGG - Intergenic
996228366 5:121030403-121030425 GTTCCTAACAGGCCACAGACTGG + Intergenic
996238750 5:121168840-121168862 GTTGCTAACAGGCCAAAGACTGG + Intergenic
996458947 5:123719148-123719170 GTTCCTAACAGGCTGCAGACTGG - Intergenic
996585131 5:125079140-125079162 GTTCCTAACCGGCCACAAACCGG - Intergenic
996713726 5:126569026-126569048 GCTCCTAATAGGCCACAGACTGG - Intronic
997172409 5:131736508-131736530 GTTCCTAACAGGCCATGGACTGG - Intronic
997221945 5:132176531-132176553 GTTGCTAACAGGCCACTGACCGG - Intergenic
997498970 5:134356378-134356400 ATTCCTAACAGGCCACAGAATGG + Intronic
997546730 5:134714317-134714339 GTTCCTAACAGGCCACCCACTGG - Intronic
997648923 5:135500628-135500650 GTTCCTAACAGGCCATGGACTGG - Intergenic
997693850 5:135845994-135846016 GTTCCTAACAGGCCACAGGCTGG - Intronic
997740897 5:136252846-136252868 ATTCCTAACAGGCCACAGACTGG + Intronic
997811520 5:136975025-136975047 GTTCCTAAGAGGCCACAGACTGG + Intergenic
997924330 5:138014320-138014342 GTTCCTAACAGGCCACAGACTGG - Intronic
998008145 5:138671225-138671247 GTTCCTAACAGGCCAGGGACTGG + Intronic
998926707 5:147134701-147134723 GTTCCTAACAGACCACAGACTGG + Intergenic
999502873 5:152164393-152164415 GTTCCTAACAGACCACAACCTGG - Intergenic
999512661 5:152268936-152268958 GTTCCTAACAGGCCATAGACTGG + Intergenic
999516896 5:152310687-152310709 GTTCCTAACAGGCCATGGACTGG + Intergenic
999559297 5:152782844-152782866 GTTCCTAACAGGGCACAGACTGG + Intergenic
999587234 5:153103423-153103445 GTTCCTAACAGGCCACAAACTGG - Intergenic
999762076 5:154710164-154710186 GTTTCTAACAGGCCACAGACTGG + Intergenic
1000308740 5:160020495-160020517 GTTCCTTACAGGCCACAGACTGG - Intronic
1000609398 5:163358001-163358023 GTTCCTAACAGGCCATGACCTGG - Intergenic
1001225431 5:169940823-169940845 GTTCCTACCTGGCCACAGACTGG + Intronic
1001631004 5:173175464-173175486 GTTCCTAACAGGCCATGAATTGG + Intergenic
1002195566 5:177499028-177499050 GTTCCTAACAGGCCACAAACGGG - Intergenic
1002323682 5:178390994-178391016 GTTCCTAACAGGCCACAAACTGG - Intronic
1002449136 5:179309158-179309180 GCTCCTAACTGGCCTCTACCCGG - Intronic
1002911473 6:1494328-1494350 ATTCCCAACAGGCCACAGACTGG + Intergenic
1002949659 6:1797040-1797062 GTTCCTAACAGGCCATATACTGG - Intronic
1003141761 6:3477721-3477743 GTTCCTAACAGACCACAGACTGG + Intergenic
1003696680 6:8412903-8412925 GTTCCTAACAGGCCACGGACTGG + Intergenic
1003779790 6:9411649-9411671 GTTCCTAACAAGCCACACACTGG + Intergenic
1003850789 6:10220473-10220495 GTTCCTAACAGGCCATGGACTGG + Intergenic
1003882339 6:10490086-10490108 GTTCCTAACAAGCCACAGACTGG - Intergenic
1004699456 6:18065391-18065413 GTTCCTAACAGGCCACCAACTGG - Intergenic
1004795629 6:19080167-19080189 GTTCCTAACAGGCCACAGACCGG - Intergenic
1004852271 6:19712385-19712407 GTTCCTAACAGGTCACAGACTGG - Intergenic
1004875219 6:19944560-19944582 GTTCTCAACAGGCCACAGACTGG + Intergenic
1005086784 6:22015161-22015183 GTTCCTAACAGGCCACAGACTGG - Intergenic
1005283317 6:24298283-24298305 GTTCCTAACAGGCCACGGAATGG + Intronic
1005387973 6:25304651-25304673 GTTCCTAACAGGCCACAGACTGG + Intronic
1005660526 6:27994259-27994281 GTTCCTAACAGGCCACGGACTGG - Intergenic
1005932762 6:30496191-30496213 GTTCCTAACAGGCCATGGACCGG + Intergenic
1006237341 6:32645545-32645567 GTTTCTAACAGGCCACCAACTGG + Intronic
1006273954 6:32986264-32986286 GTTCCTACCAGGCCACGGACTGG + Intergenic
1006595399 6:35189500-35189522 GTCCCTAACAGACCACAGACAGG - Intergenic
1006595470 6:35190080-35190102 GTCCCTAACAGACCACAGACAGG + Intergenic
1006720169 6:36145076-36145098 GTTCCTAACAGGCCACAGACAGG + Intergenic
1006871351 6:37255087-37255109 GTTCCTAACAGGCAACAGACAGG + Intronic
1007152647 6:39709515-39709537 GTTCCTAACAGGCCACAGACTGG + Intronic
1007346419 6:41232914-41232936 ATTCCTAACAGGCCAGGAACTGG + Intronic
1007895366 6:45350872-45350894 GTTCCCAACAGGCCACGAACTGG - Intronic
1008055753 6:46944378-46944400 GTTCCTAACAGGACACTGACTGG + Intronic
1008130235 6:47712939-47712961 GATCCTAAGAGGCCACAGCCCGG - Intronic
1008523813 6:52387727-52387749 GTTCCTAACAGGCCACAGACAGG - Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1008950834 6:57156993-57157015 GTTCTTAACAGGCCACAGACTGG + Intronic
1008955662 6:57213266-57213288 GTTCCTAACAGGCCACAGAACGG + Intronic
1009439633 6:63661932-63661954 GTTCCTAACAGGCCCCAAACTGG - Intronic
1009513418 6:64582207-64582229 GTTCCTAACAGGCCACAGACAGG - Intronic
1009523772 6:64717593-64717615 GTTCCTAACAGGCCACGAACTGG + Intronic
1009582068 6:65549134-65549156 GTTCCTAAATGGACACAAACCGG + Intronic
1009920929 6:70060411-70060433 GTTCCTAACAGGCTGCGAACTGG - Intronic
1009922747 6:70083022-70083044 GTTCCTAACAGTCCACAGACCGG + Intronic
1009962087 6:70535383-70535405 GTTCCTAAGAGGCCACAGACAGG - Intronic
1010120914 6:72375105-72375127 CTTCCCAACAGGCCACAGACTGG + Intronic
1010776632 6:79894055-79894077 GTTCCTAACAGGCCACAAACCGG - Intergenic
1011027624 6:82886467-82886489 GTTCCTAATAGGACACAGGCTGG + Intergenic
1011139878 6:84141136-84141158 GTTCCTAACAGGCCATGAACTGG + Intronic
1011292741 6:85793335-85793357 ATTCCTAACAGTCCACAGACTGG - Intergenic
1011570644 6:88730658-88730680 GTTCCTAACAGGCCATGGACTGG + Intronic
1011637646 6:89389078-89389100 GTTCCTAACAGGCCACAGACTGG + Intronic
1012211995 6:96530927-96530949 GTTCCTAACAGGCCACAGACTGG - Intronic
1012753208 6:103189839-103189861 GTTCCTAACAGGCTAGAGACTGG - Intergenic
1012828676 6:104179626-104179648 GTTCCTAACAGGCCAGAGATGGG + Intergenic
1012973391 6:105754914-105754936 GTTCCTAACAGGCCACAGAATGG - Intergenic
1013343897 6:109240833-109240855 GTTCCTAACAGGAAACCACTAGG + Intergenic
1013377280 6:109529917-109529939 GTTCCTCATAGGCCACAGACTGG + Intronic
1013465855 6:110416457-110416479 GTTCCTAACAGGCCACGGACTGG + Intergenic
1013501000 6:110751195-110751217 GTTCCTAACAGGCCACCAACTGG - Intronic
1014151522 6:118061947-118061969 GTTCCTAACAGGCCACGGACTGG + Intronic
1014304970 6:119728383-119728405 GTTCCTAACAGGACACAGACTGG + Intergenic
1014460446 6:121688322-121688344 GTTCCTAACAGGCCACAGACAGG + Intergenic
1014474650 6:121857655-121857677 GTTCCTAACAGGCCACTGACTGG - Intergenic
1014720507 6:124911926-124911948 GCTCCTAATAGGCCACAGACTGG + Intergenic
1014747550 6:125217632-125217654 GTTCCTAACAGGTAACAGACCGG + Intronic
1014830857 6:126101123-126101145 GTTCCTAACAGGCCAAGGACAGG + Intergenic
1014895900 6:126898658-126898680 GTTCCTAACAGGCCACAGACTGG + Intergenic
1015066805 6:129039889-129039911 GTTCCTAACAGGCCACAGGCTGG + Intronic
1015147720 6:130006009-130006031 GTTCCTAACAGGCTACATACTGG + Intergenic
1015201226 6:130583524-130583546 GTTCCTAACAGGCCACGGACTGG + Intergenic
1015305044 6:131697798-131697820 GTTCCTAACAGGCCACAGACAGG + Intronic
1015553851 6:134440677-134440699 GTTTCTAACAGGCCACAGACTGG - Intergenic
1015672741 6:135708765-135708787 GTTCCTAACGGGCCACGGACTGG + Intergenic
1015942760 6:138468396-138468418 GTTCCTAACAGGCCACAGATGGG - Intronic
1015953730 6:138579194-138579216 GTTCCTAATAGGCCACAGCCTGG + Intronic
1015985663 6:138881875-138881897 GTTCCTAACAGGCCACAGACTGG + Intronic
1016025883 6:139286582-139286604 GTTCCTAACAGGCCACGGACTGG - Intronic
1016196765 6:141353437-141353459 GTTCCTAACGGGCCACAGAGGGG - Intergenic
1016634265 6:146269554-146269576 GTTCCTAACAGCCCACAGATTGG - Intronic
1016666908 6:146652928-146652950 GTTCCTAACAGGCCACAGATTGG - Intronic
1016757012 6:147698185-147698207 GTTCCTAACAGGCCACAGACCGG + Intronic
1016841409 6:148529171-148529193 CTTCTTAACAGGCCACAGACGGG + Intronic
1017055785 6:150434497-150434519 GTTCCTAAGAGGCCACGGACTGG - Intergenic
1017061015 6:150485080-150485102 GTTCCTAACAAGCCACAGACCGG + Intergenic
1017093759 6:150785733-150785755 GTTCCTAACAGGTCACAAACTGG - Intronic
1017216280 6:151911111-151911133 GTTCCTAACAGGCCATGAACTGG + Intronic
1017735597 6:157360088-157360110 GTTCCTAACAGGCCATAGACAGG + Intergenic
1017784850 6:157747127-157747149 GTTCCTAACAGGCCATGGACTGG + Intronic
1018097021 6:160397366-160397388 GTTCCTAACAGGCCACAAACTGG + Intronic
1018230000 6:161666204-161666226 GTTCCTAACAGGCTACGGACAGG - Intronic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1018489301 6:164275414-164275436 GTTCCTAACAGGCCACAGACTGG - Intergenic
1018515454 6:164574591-164574613 GTTCCTAACAGGTCATGAACTGG + Intergenic
1018555006 6:165039904-165039926 ATTCCTAACAGGCCATGAACTGG + Intergenic
1018751957 6:166814462-166814484 GTTCCTAACAGGCCACGGGCTGG - Intronic
1019866128 7:3712103-3712125 GTTCCTAACAGGCCATGGACTGG - Intronic
1019979691 7:4612363-4612385 GTTCCTAACAGGCCAAGAAGTGG - Intergenic
1020826489 7:13035542-13035564 ATTCCTAACGGGCCACAGACAGG - Intergenic
1021177285 7:17463608-17463630 GCTCCTAACAGGCCACGGACAGG - Intergenic
1021554361 7:21904445-21904467 GTTCCAAACAGGCCACAGACTGG - Intronic
1021738506 7:23662266-23662288 GTTTCTAATAGGCCACAGACCGG - Intergenic
1021749979 7:23787448-23787470 GTTCTTAACAGGCCACAGACTGG - Intronic
1022114156 7:27248153-27248175 GTTGCTCAGAGACCACAACCTGG - Intergenic
1022546887 7:31198173-31198195 GTTCCTAACAGGCTACGGACTGG + Intergenic
1023277523 7:38535876-38535898 GTTCCTCACCGGCCACAAACTGG + Intronic
1023327030 7:39071420-39071442 GTTCCTAACAGGCCACAGACTGG + Intronic
1023337211 7:39183015-39183037 GTTTCTAACAGGCCATGAACTGG - Intronic
1023383922 7:39635849-39635871 GTTCCTAACAGGCCACAGACTGG + Intronic
1023549098 7:41349914-41349936 GTTCCTAACAGGCCACGGACCGG - Intergenic
1023591005 7:41780509-41780531 GTTCCTAACAGGCCACAGACTGG - Intergenic
1023655693 7:42418255-42418277 GTTCTTAACAGGCCATAGACTGG + Intergenic
1024322027 7:48080028-48080050 GTTCCTAACAGGCCATGCACTGG - Intergenic
1024410408 7:49034235-49034257 GTTTCTAACAGGCCACAGACTGG + Intergenic
1024628103 7:51225583-51225605 GTTCCTGCCAGGGCACACCCAGG - Intronic
1024690424 7:51795490-51795512 GTTCCTAACAGGCCACAGACAGG + Intergenic
1025077282 7:55953951-55953973 GTTCCTAACAGGCCACTGAATGG + Intronic
1025104732 7:56161804-56161826 GTTCCTAACAGGTCACAGACTGG - Intergenic
1025105924 7:56172046-56172068 GTTCCTAACAGGCTACATACTGG + Intergenic
1025218775 7:57086136-57086158 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025235048 7:57228733-57228755 GTACAAAACAGGCCACAAGCTGG - Intergenic
1025625607 7:63218617-63218639 GTTCCTAACAGGCCATAGCCTGG + Intergenic
1025629700 7:63259724-63259746 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025652574 7:63484303-63484325 GTTCCTAACAGGCCACGGACTGG + Intergenic
1025656509 7:63524554-63524576 GTTCCTAATAGGCCATAGCCTGG - Intergenic
1026149607 7:67776833-67776855 GTTCCTAACAGGCCAGAAACAGG + Intergenic
1026300543 7:69094055-69094077 GTTCCTGACAGGCCACAGACTGG + Intergenic
1026310101 7:69175852-69175874 GTTGCTAACAGGCCACAGACCGG - Intergenic
1026313781 7:69210866-69210888 GTTCCTAACAGGCCACAGACTGG - Intergenic
1026315068 7:69220785-69220807 GTTCCTAACAGGCTGCAGACTGG + Intergenic
1026316032 7:69228457-69228479 GTTCCTAACAGGTCACAGACTGG + Intergenic
1026574738 7:71562727-71562749 GTTCCTAACAGGCCATCAACTGG + Intronic
1026620446 7:71945480-71945502 GTTCCTAACAGGCCACAGACTGG - Intronic
1027195882 7:76029943-76029965 GTTCCTAACAGACCACAGACTGG + Intronic
1027225762 7:76242929-76242951 GTTCCTAATAGGCCACAGAGTGG + Intronic
1027398784 7:77786397-77786419 GTTCCTAATAGGCCACGGGCTGG + Intergenic
1027613582 7:80393038-80393060 GTTTCTAACAGGCCACGGACTGG + Intronic
1027787802 7:82602176-82602198 ATTCCTAACAGGCCACATACCGG - Intergenic
1028057217 7:86261298-86261320 GTTCCTAACAGGCCATGGACGGG + Intergenic
1028181877 7:87733844-87733866 GTTCCTAACAGGCCACGGACAGG + Intronic
1028297109 7:89147587-89147609 GTTCCTAACAGGCAACAGACTGG - Intronic
1028570297 7:92279228-92279250 GTTCCTAACAGGCCATGGACAGG + Intronic
1028761609 7:94503330-94503352 GTTCCTAACAGCTCACAGACTGG + Intergenic
1028798889 7:94938087-94938109 GTATCTAACAGGCCACAGACTGG - Intronic
1029034396 7:97503588-97503610 GTTCTTAACAGGCCACAGACCGG - Intergenic
1029151009 7:98480477-98480499 GTTCCTAACAGGCCATGAACTGG - Intergenic
1029355511 7:100048951-100048973 GTTCCTAACAGGCCATGGACTGG + Intergenic
1029431793 7:100535999-100536021 GTTCCTAACAGGCCACAGACAGG + Intergenic
1029491039 7:100870279-100870301 GTTCCTAACAGGCCATGGCCTGG + Intronic
1030845186 7:114400786-114400808 GTTCCTAACAGGCCATGGACTGG + Intronic
1030904003 7:115160312-115160334 GTTCCTAAAAGGCCATGAACTGG - Intergenic
1031045200 7:116879705-116879727 GTTCCTAACAGGCCCCAGACTGG + Intronic
1031221850 7:118976535-118976557 GTTCCTAACAGGCCACAAAGGGG + Intergenic
1031826747 7:126575105-126575127 GTTCCTAACAGGCCACAAACCGG - Intronic
1032231233 7:130076266-130076288 GTTCCTAACAGGCCATGGACCGG + Intronic
1032446093 7:131984874-131984896 GTTCCTAACAGGCCACAGAGTGG - Intergenic
1032615124 7:133460320-133460342 GTTCCTAACAGGCCATGGGCTGG + Intronic
1032707313 7:134432609-134432631 GTTCCTAACAGGCCATGGACTGG + Intergenic
1032878848 7:136067027-136067049 GTTCCTAACAGGCCACGAACTGG + Intergenic
1033135457 7:138780431-138780453 GTTCCTAACAGGCCATGGACTGG + Intronic
1033292520 7:140099542-140099564 GTTCCTAACAGGCCACGGACTGG - Intronic
1033335240 7:140446717-140446739 GTTCCTAACAGGCCACGGATTGG + Intergenic
1033390051 7:140918477-140918499 GTTCCTAACAGGTCACGGACTGG + Intronic
1033479826 7:141728705-141728727 GTTCCTAACAGGCCACAGACTGG - Intronic
1033684786 7:143628443-143628465 GTTCCTAACAGGCCATGGACTGG - Intronic
1033687961 7:143707662-143707684 GTTCCTAACAGGCCATGGACTGG - Intronic
1033699826 7:143829178-143829200 GTTCCTAACAGGCCATGGACTGG + Intergenic
1034007991 7:147495809-147495831 GTTCCTAAAAGGCCACAAACTGG - Intronic
1034046178 7:147930048-147930070 GTTCCTAACAGGCCACAGACTGG + Intronic
1034144162 7:148853559-148853581 GTTCCTAACGGGCCACAGACGGG + Intronic
1034485474 7:151358396-151358418 GTTCCTAACAAGCCACGGACTGG - Intronic
1034685345 7:152966306-152966328 GTTCCAAACAGGCCACAGAGTGG + Intergenic
1035015061 7:155758582-155758604 GTTCCTAACAGGCCACAGACTGG + Intronic
1035286092 7:157808137-157808159 GTTCCTAACAGGCCACAGACTGG - Intronic
1035953439 8:4050089-4050111 CTTCCCAACAACCCACAACCTGG - Intronic
1036005089 8:4653013-4653035 GTTCCTAACAGGCCACAGATAGG + Intronic
1036116029 8:5961722-5961744 GTTCCTAACAGGCTACAAACTGG + Intergenic
1036119849 8:6004137-6004159 GTTCCTAGCAGGCCACGGACTGG - Intergenic
1036132751 8:6131697-6131719 GTTCCTAACAGGCCACAAACAGG + Intergenic
1036159700 8:6375693-6375715 GTTCCTAACAGGCCACAAACTGG - Intergenic
1036172017 8:6496420-6496442 GTTCCTAATAGGCCACAGACTGG + Intronic
1036226682 8:6964999-6965021 GTTCCTAACAGGCCATGGACCGG - Intergenic
1036431689 8:8697999-8698021 GTTCCTGACAGGCCACAGACTGG - Intergenic
1036445427 8:8817942-8817964 GTTCCTAACAGCCCATGAACTGG + Intronic
1036586300 8:10126979-10127001 GTTCCCAACAGGCCACAGCCTGG + Intronic
1036966282 8:13301688-13301710 GTTCCTAACAGATCACAGACCGG - Intronic
1037109962 8:15154118-15154140 GTTCCTAACAGGCCATGAACTGG + Intronic
1037530334 8:19766614-19766636 GTTCCTAACAGGCCAGAGACTGG - Intergenic
1037603613 8:20419538-20419560 GTTCCTAACAGGCCACTGACTGG + Intergenic
1037690392 8:21176907-21176929 GTTCCTAACAGGCCACAGACTGG + Intergenic
1037923349 8:22824903-22824925 GTTCCTAACAGGCCATGGACCGG + Intronic
1038191088 8:25321731-25321753 GTTCCTAACAGGCCACAGACTGG + Intronic
1038285237 8:26200518-26200540 GTTCCTAACAGGCCATGAACTGG - Intergenic
1038351569 8:26780655-26780677 GTTTCTAACAGGCCACAGACTGG - Intronic
1038368327 8:26960906-26960928 ATTCCTAACAGGCCACAGAATGG - Intergenic
1038507340 8:28095915-28095937 GCTCCTAACAGGCCATGAACCGG - Intronic
1038676008 8:29623555-29623577 GTTCCTAACAGGCCACGGACTGG + Intergenic
1038706586 8:29899570-29899592 GTTCCTAACAGGCCACAGACTGG - Intergenic
1038829142 8:31037404-31037426 GTTCCTAACAGGCCATGGACTGG + Intronic
1039042333 8:33419561-33419583 GTTCCTAACAGGCCACGGACAGG + Intronic
1039114241 8:34074493-34074515 GTTCCTAACAGGCCACAGATGGG + Intergenic
1039604059 8:38866468-38866490 GTTCCTAAGAGGCCAGTCCCTGG + Intergenic
1039909468 8:41812940-41812962 GTTCCTAACAGGCCCCGGACAGG + Intronic
1039961094 8:42248306-42248328 ATTCCTAACAGGCCACAGACCGG + Intergenic
1040031094 8:42824428-42824450 GTTCCTAACAGGCCACAGACTGG + Intergenic
1040099682 8:43487458-43487480 GTTCCTAACAGGCCATGGGCTGG + Intergenic
1040858975 8:51979393-51979415 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1040907500 8:52483710-52483732 GTTCCTAACAGGCCGTGAACTGG + Intergenic
1041333621 8:56755197-56755219 GTTCCTAACAGGCCAAGGACTGG + Intergenic
1041439721 8:57881807-57881829 GTTCCTAACAGGTCGCAGACAGG - Intergenic
1041498547 8:58514337-58514359 GTTCCTAAAAGGCCACAGACGGG - Intergenic
1041835632 8:62210200-62210222 GTTCCTAACAGGACACAAATAGG - Intergenic
1041928266 8:63260278-63260300 GTTCCTAACAGGCCACAGACTGG - Intergenic
1042347406 8:67741463-67741485 GTTTCTAACAGGCCATCAACTGG - Intronic
1042848676 8:73193786-73193808 GTTCCTAACAGGCCATGGACTGG - Intergenic
1042981424 8:74533196-74533218 GTTCCTAACAGGCCAGGAACCGG + Intergenic
1043007149 8:74833877-74833899 GTTTCTAACAGGCCACAGATGGG - Intronic
1043126220 8:76399122-76399144 GTTCCTAACAGGCCATGGACAGG - Intergenic
1043187318 8:77170416-77170438 TTTCCTAACAGGACACAGACTGG + Intergenic
1043417920 8:80070639-80070661 GTTCCTAACAGGCCACAGATGGG + Intronic
1043544698 8:81302180-81302202 GTTCCTAACAGGCCACTGCCGGG - Intergenic
1043583582 8:81740501-81740523 GTTCCTAACAGGACATGAACCGG + Intronic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1043935835 8:86141185-86141207 GTTACTAACAGGCCACGGACTGG + Intronic
1043979164 8:86618255-86618277 GTTCCCAACAGGCCACCGACTGG + Intronic
1044136711 8:88594761-88594783 GTTCCTAACAGGCCACAGACTGG + Intergenic
1044365144 8:91336293-91336315 GTTCCTAACAGACCATGAACTGG - Intronic
1044586791 8:93875895-93875917 GTTCATAACAGGCCACAGGCTGG + Intronic
1044866393 8:96575101-96575123 GTTCCTAACAGGCCACGGATCGG + Intronic
1044900560 8:96939361-96939383 ATTCCTAACAGGCCACAGACTGG + Intronic
1045087621 8:98703626-98703648 GTTACTAACAGGGCACAGTCTGG - Intronic
1045175988 8:99725289-99725311 GTTCCTAACAGGCCATGGGCTGG - Intronic
1045283746 8:100772342-100772364 GTTCCTAACAGGCCACAGAAGGG + Intergenic
1045294410 8:100861027-100861049 GTTCCTAACAGGCCACTGACTGG + Intergenic
1045885949 8:107097978-107098000 GTTCCTAACAGGCCACAGAATGG + Intergenic
1045980861 8:108185609-108185631 GTTCCTAACAGGCCACCAACTGG + Intergenic
1046022902 8:108687876-108687898 GTTCCTAACAGGCCACGTACAGG + Intronic
1046070385 8:109245859-109245881 GTTCCTAAAAGGCCACTGACTGG - Intronic
1046163514 8:110397834-110397856 GTCCCTAACAGGCCATAGGCAGG + Intergenic
1046524523 8:115367553-115367575 GTTCCTAACACGCCACAGACTGG - Intergenic
1046534950 8:115497417-115497439 GTTCCTAACAGGCCACAGACTGG + Intronic
1046622497 8:116543157-116543179 GTTCCTAACAGGCCACGGACCGG + Intergenic
1047177266 8:122553689-122553711 GTCCCTAACAGGCCACGGACTGG + Intergenic
1047188551 8:122657412-122657434 GTTCCTAACAGGCCATAGACTGG + Intergenic
1047301605 8:123618296-123618318 TTTCCCAACAGGTCACAAACTGG - Intergenic
1047478632 8:125259294-125259316 GTTCCTAACAGGCCACCGACTGG - Intronic
1047514035 8:125538035-125538057 GTTCCTAACAAGCCACAGATTGG + Intergenic
1047676487 8:127208437-127208459 GTTCCTAACAGGCCACAAAATGG + Intergenic
1048044823 8:130763734-130763756 GTTCCTAACAGGCCACAGACAGG + Intergenic
1048140087 8:131785828-131785850 GTTCCTTACAGGCCACGGGCAGG + Intergenic
1048258471 8:132924329-132924351 GTTCCTAACAGGCCATGGACTGG + Intronic
1048583415 8:135749934-135749956 GTTCTTAACAGGCCACAGACAGG - Intergenic
1048587025 8:135783605-135783627 GTTCCTAACAGGCCATGGACTGG - Intergenic
1048599079 8:135899782-135899804 GTTCCTCACAGGCCACAGGCAGG - Intergenic
1048723760 8:137358434-137358456 GTTCCTAACAGGCCACAGATTGG - Intergenic
1048724219 8:137363315-137363337 GTTCCTAACAGGCCACGGAGTGG + Intergenic
1049132725 8:140862598-140862620 GTTCCTAATAGGCTACTAACTGG - Intronic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049626056 8:143621990-143622012 GTTCCTAACAGGCCACAGACCGG + Intergenic
1050127668 9:2376063-2376085 GTTCCTAACAGGCCACGGATTGG + Intergenic
1050131272 9:2415207-2415229 GCTCCTAACAGGCCACCAACAGG + Intergenic
1051000945 9:12280961-12280983 GTTCCTAACAGCCCACAGACTGG + Intergenic
1051286413 9:15501931-15501953 GTTCCTAACAGGCCACGGACGGG - Intronic
1051554335 9:18365757-18365779 GTTCCTAACAGGCCACAGATAGG - Intergenic
1051665490 9:19464259-19464281 GTTCCTAACAGGCCACAAAGGGG + Intergenic
1051689571 9:19695989-19696011 GTTCTTAACAGGCCACAGACTGG - Intronic
1051831905 9:21288710-21288732 GTTCCTAACAGGCCATGGACCGG - Intergenic
1052038072 9:23705805-23705827 GTTCCTAACAGGCCACGGACTGG + Intronic
1052293128 9:26866933-26866955 GTTCCTAACAGGCCACAGATTGG - Intronic
1052390417 9:27872564-27872586 GTTCCTAACAGGCCACAAACTGG + Intergenic
1053136860 9:35656503-35656525 GAGCCTAACAGGCCACAGGCTGG - Intergenic
1053153166 9:35755758-35755780 CTTCCTAACAGGCCACAGACTGG + Exonic
1053235754 9:36452505-36452527 TTTGCTAACATGCCACAACATGG - Intronic
1053329055 9:37187494-37187516 GTTCCTAACAGGCCACGAACTGG + Intronic
1053451809 9:38199844-38199866 GCTCCTCACAAGGCACAACCAGG - Intergenic
1054737534 9:68770533-68770555 GTTCCTTACAGGCCGCAGACTGG - Intronic
1054809768 9:69425539-69425561 GTTCCTAACAGGCCACAGACTGG - Intergenic
1054978571 9:71176938-71176960 AGTTCTAACAGGCCACAAACTGG - Intronic
1055489340 9:76788927-76788949 CTTCCTAACAAGGCACAGCCAGG - Intronic
1055539747 9:77291063-77291085 GTTCCTAACAGGTCACAGACCGG - Intronic
1055542407 9:77325292-77325314 CTTCTTAACAGGCCACAGACCGG + Intronic
1055909324 9:81329314-81329336 GTTCCTAACAGGCCACAGACTGG - Intergenic
1055965416 9:81860929-81860951 GTTCCTAACAGGCCATGGACTGG + Intergenic
1056144088 9:83712017-83712039 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056189175 9:84167828-84167850 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056700619 9:88903282-88903304 GTTTCTGACAGGCCATAGCCAGG + Intergenic
1056885055 9:90433752-90433774 GTTCCTAACAGGCCACAGACAGG - Intergenic
1057007164 9:91570380-91570402 GTTCCTAACAGGCCACAGACTGG + Intronic
1057460175 9:95254026-95254048 GTTCCTAACAGGCCACGGACTGG + Intronic
1058043997 9:100336285-100336307 GTTCCTAACAGGCCGCGGACTGG - Intronic
1058136411 9:101312878-101312900 CTTCCTGACAGGCCTCAACCGGG + Exonic
1058667041 9:107328715-107328737 GTTCCTAACAGGCCAATGGCTGG + Intronic
1058824945 9:108766892-108766914 GTTCCTAACAGGCCACTGACTGG - Intergenic
1058864728 9:109151292-109151314 GTTCCTAACAGGCCATGGACTGG - Intronic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059164346 9:112064205-112064227 GTTCCTAACAGGCCACAGACTGG - Intronic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1059429589 9:114241904-114241926 GTTCCTCACAGCACACAACGGGG + Intronic
1059795734 9:117694451-117694473 GTTCCTAACAGGCCACAGACTGG - Intergenic
1060333921 9:122703918-122703940 GTTCCTAACAGACCACAGATTGG - Intergenic
1060433812 9:123575378-123575400 GTTCCGAACAGGCCATGAACTGG + Intronic
1060643266 9:125257078-125257100 ATTCCTAACAAGCCACAGACGGG - Intergenic
1061527830 9:131182296-131182318 GTTCCTAAGAGGCCACAGACCGG - Intronic
1185742375 X:2544139-2544161 GTTCCTAACAGGCCACAGACTGG - Intergenic
1185811164 X:3112040-3112062 GTTCTTAACAGGCCACGAACAGG + Intronic
1185837445 X:3358258-3358280 GTTCCCAACAGGCCACCGACTGG - Intergenic
1185934774 X:4243903-4243925 GTTCCTAACAGGCCAAGGACTGG - Intergenic
1185971531 X:4670718-4670740 GTTCCTAACATGCCACGGACTGG - Intergenic
1185981513 X:4785120-4785142 GTTCCTAACAGGCCACAGACCGG - Intergenic
1186050259 X:5584808-5584830 GTTCCAAACAGGTCACAGACTGG + Intergenic
1186221673 X:7355749-7355771 GTTCCTAACAGGCCATGGACTGG - Intergenic
1186237800 X:7532245-7532267 GTTCCTAACAGGCCACGAGCCGG + Intergenic
1186565159 X:10654654-10654676 GTTCCTAACAAGCCACAGACTGG + Intronic
1187013905 X:15307601-15307623 GTTCCTAACAGGCCATGGACTGG + Intronic
1187014108 X:15308846-15308868 GTTCCTAACAGGCCACGGAATGG - Intronic
1187022007 X:15393484-15393506 GTTCCTAACAGACCACCAATTGG - Intronic
1187276506 X:17820647-17820669 GTTCTTAAGAGGTCAGAACCAGG - Intronic
1187460673 X:19484144-19484166 GTTCCTAACAGGCCACTGACCGG - Intronic
1187669390 X:21654426-21654448 GCTGTTTACAGGCCACAACCTGG - Exonic
1187909101 X:24093912-24093934 GTTCCTAACAGGCCAAGGACCGG - Intergenic
1188065935 X:25659290-25659312 GTTCCTAACAGGCCACAGACTGG + Intergenic
1188232865 X:27687042-27687064 GTTCCTAACAGGCCACAGACAGG + Intronic
1188333773 X:28902732-28902754 GTTCCTAACAGGCCATATACTGG - Intronic
1188356633 X:29199727-29199749 GTTACTAACAGGCCACGGACTGG + Intronic
1188469216 X:30518351-30518373 GTTCTTAAGAGGCCACAGCCTGG + Intergenic
1188692645 X:33149464-33149486 GTTCCTCACAGGCCACAGATGGG + Intronic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1189503314 X:41584710-41584732 GTTCCTAACAGGCCACGGATGGG + Intronic
1189749852 X:44209683-44209705 GTTCCTAACAGGCCACGGACTGG - Intronic
1189880212 X:45483181-45483203 GTTCCTAACAGGCCACAAACTGG + Intergenic
1190027191 X:46935440-46935462 GTTCCTAACAGGCCACAGACTGG - Intronic
1190068749 X:47261841-47261863 GTTCCTAACAGGCCATGGACTGG + Intergenic
1190299630 X:49049451-49049473 GCTCCTAACAGGCCACTGACTGG + Intergenic
1190402182 X:50048320-50048342 GTTCCTAACAGGCCACAGACTGG + Intronic
1191041298 X:56083655-56083677 GTTTCTAACAGGCCACTGACTGG - Intergenic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1192295354 X:69842032-69842054 GTTCCTAACAGGCCACAGATTGG - Intronic
1192407555 X:70901709-70901731 GTTCCTAACAGGCCAGAGACAGG + Intronic
1192496690 X:71620950-71620972 GTTCCTAACAGGCCACAGACCGG + Intergenic
1192548661 X:72035856-72035878 GTTCCAAACAGGCCACAGACTGG - Intergenic
1193037296 X:76965946-76965968 GTTCCTAACAGGCCACGAACCGG + Intergenic
1193794135 X:85852474-85852496 GTTTCTAACAGGCCGCAGACTGG - Intergenic
1194786259 X:98087560-98087582 GTTCCTAACAGGCCATGGACCGG + Intergenic
1194945594 X:100063276-100063298 GTTCCTAACAGACCACAGACTGG - Intergenic
1195219197 X:102730388-102730410 GTTCCTAACAGGCCATGGACGGG + Intronic
1195423330 X:104699579-104699601 GGTCCTAACAGGCCACTGACTGG + Intronic
1195465779 X:105177064-105177086 GTTCCTAGCAGGACACAGACTGG - Intronic
1195493250 X:105498847-105498869 GTTCCCAAAAGGCCACAGACTGG - Intronic
1195656231 X:107333970-107333992 GTTCCTAACAAGCCACAGACTGG + Intergenic
1195768833 X:108327079-108327101 GTTCCTAACAGGCCACAGACAGG - Intronic
1195922379 X:109996399-109996421 GTTCCTAACAGGCCACAGACTGG + Intergenic
1195928430 X:110049593-110049615 GTTCCTAACAGGCCATAGATTGG + Intronic
1196488578 X:116243295-116243317 GTTCCTCACAGGCCATGAACTGG + Intergenic
1196754444 X:119145549-119145571 GTTCCTAACAGGCTACAGACTGG - Intronic
1196902930 X:120403496-120403518 GTTCCTAACAGGCCATGGACTGG + Intergenic
1197150244 X:123212929-123212951 GTTCCTAACAGGTCATGAACTGG - Intronic
1197239001 X:124103340-124103362 GTCCCTAACAGGCCACGTTCTGG - Intronic
1197447699 X:126571648-126571670 GTTCCTAATAGGCCATTAACCGG - Intergenic
1197641711 X:128975231-128975253 GTTCCTAACAGGCCACGGTCTGG + Intergenic
1197840846 X:130744801-130744823 GTTCCTAACAGGCCACGGACCGG - Intronic
1197982142 X:132228283-132228305 GTTCCTAACAGGCCACAGACCGG - Intergenic
1198271076 X:135056416-135056438 GTTCCCAACAGGCCACAGACTGG + Intergenic
1198617680 X:138477545-138477567 GTTCCTAACAGGCCACAGACTGG + Intergenic
1198791825 X:140354639-140354661 GTTCATCAGAGGCCACATCCTGG + Intergenic
1198813950 X:140566863-140566885 GTTCTTAACGGGCCACAGACTGG + Intergenic
1199023073 X:142904963-142904985 GTTCCTAACAGGCCAAAGATAGG + Intergenic
1199079054 X:143556110-143556132 GTTTCCAACAGGCCACGAACCGG - Intergenic
1199213844 X:145245090-145245112 GTTTCTAACAGGCCACGAACCGG + Intergenic
1199271120 X:145883602-145883624 GTTGCTACCAGGCCACAGACTGG + Intergenic
1199283955 X:146035748-146035770 GTTCCTAACAGGCCACGGACTGG - Intergenic
1199659929 X:150038571-150038593 GTTCCTAACAGGCCACGGACTGG + Intergenic
1200368507 X:155694929-155694951 GTTCCTAACAGGCCACAGACTGG + Intergenic
1200974470 Y:9193905-9193927 GTTCCTAACAGGACACAGGTGGG - Intergenic
1201238362 Y:11933555-11933577 GTTCCTAACAGGTCACTGACTGG + Intergenic
1201238852 Y:11938490-11938512 GTTCCTAACAAGCCACAGACAGG - Intergenic
1201322637 Y:12717111-12717133 CTTCCTAACAGGCCACAGTGTGG - Intronic
1201589816 Y:15602820-15602842 GTTCCTAACAGGCCACAGACTGG - Intergenic
1201694161 Y:16806474-16806496 GTTCCTACGAGGCCACAGACTGG - Intergenic
1201960418 Y:19675025-19675047 ATTTCTAACAGGCCATAAACTGG + Intergenic