ID: 1078951294

View in Genome Browser
Species Human (GRCh38)
Location 11:16137618-16137640
Sequence CTGCTTACCTTAAGGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078951292_1078951294 26 Left 1078951292 11:16137569-16137591 CCAGTAGGTATCAATTTTCTCAT 0: 1
1: 0
2: 2
3: 28
4: 259
Right 1078951294 11:16137618-16137640 CTGCTTACCTTAAGGAATCAAGG 0: 1
1: 0
2: 1
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078951294 Original CRISPR CTGCTTACCTTAAGGAATCA AGG Intronic
907065039 1:51472883-51472905 CTGCTTTCCTGAAAAAATCAGGG - Exonic
907166983 1:52421532-52421554 CTGCCTTCCTTAAGGAAGAAAGG + Intronic
908525908 1:64987138-64987160 CTGCCTACCTTGAGGAACTAAGG - Intergenic
910202061 1:84709908-84709930 CTGCTTAGGTTCAGGAATCATGG - Intergenic
910418233 1:87025016-87025038 CTGTTTTACTGAAGGAATCATGG - Intronic
911034481 1:93526381-93526403 CTGCTGACCTTAAGGAGACATGG - Intronic
912542418 1:110427126-110427148 CTGATTCCCTTCAGGAAGCAGGG - Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
913298028 1:117341002-117341024 CTACTTGCCTTACGGAGTCATGG - Intergenic
917103114 1:171465563-171465585 CAGCTCACCTCAAGGGATCAGGG - Intergenic
918181375 1:182088045-182088067 CTGGTTACCTTAGTGACTCATGG - Intergenic
919022180 1:192120814-192120836 CTGCATTCCTTATGGAGTCACGG + Intergenic
1067562400 10:47312988-47313010 CTGAGTACCTGAAGGAATCTGGG + Exonic
1069139029 10:64800876-64800898 CTGCTTACCATAAGCAGTCAGGG + Intergenic
1069216232 10:65824801-65824823 CTGCTTCCCTTATGAAAACATGG - Intergenic
1070158965 10:73854114-73854136 CTGCTTCCCTTAAGAAATGTGGG + Intronic
1070537623 10:77391471-77391493 CTGGCTTTCTTAAGGAATCAGGG - Intronic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1071792348 10:88968493-88968515 CTGCTGACCTGAAGGAATGCAGG + Intronic
1071793088 10:88976964-88976986 CTGCTAATCTAAAGGAATCTGGG - Intronic
1073799534 10:107026217-107026239 CTGCTCACCTAAAGAAATCCAGG - Intronic
1075294309 10:121260523-121260545 ATGTTTACATTAAGGAATAAAGG + Intergenic
1075730018 10:124630517-124630539 CTCCTTACCCTCAGGAATCAGGG + Intronic
1076916636 10:133425717-133425739 CTGCTTACCCCAAGGAGTCAAGG + Intergenic
1076936740 10:133570512-133570534 CTGCTTACCCCAAGGAGTCAAGG + Intergenic
1078271975 11:9804280-9804302 CTGCTTGCTTTATGGAAACAGGG - Intronic
1078951294 11:16137618-16137640 CTGCTTACCTTAAGGAATCAAGG + Intronic
1079144237 11:17836666-17836688 CTCCTTTCCTTAAGGATTCTGGG + Intronic
1080570779 11:33554877-33554899 CTTCTTAGCTAAATGAATCATGG + Intronic
1084095226 11:66906964-66906986 CGGCTTTCCTTTAGGAATCTGGG - Intronic
1084961303 11:72718158-72718180 CTGCTTACCACAGGGTATCAGGG + Intronic
1085024510 11:73228729-73228751 CTGCTGACCCTAAGTAACCAGGG - Intronic
1087189060 11:95232721-95232743 CTGGTTTCCTTAGGGATTCAGGG + Intergenic
1090899138 11:131010587-131010609 CTTTTTAACTTAAGGCATCAGGG - Intergenic
1091296025 11:134474516-134474538 CTGCTTATCTTAAAGAATCCGGG + Intergenic
1092319008 12:7451539-7451561 CTGTTTACTTTGAGGAAACAAGG - Intronic
1092781285 12:11990127-11990149 TTGGTTACCTTAGGGAACCAGGG + Intergenic
1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG + Intronic
1095362261 12:41356952-41356974 CAGTTTACCTCAGGGAATCAGGG + Intronic
1095642079 12:44496695-44496717 CTGCATACATTAAGAACTCAAGG - Intergenic
1095811418 12:46376099-46376121 CTGCCTACCACAAGGAATAATGG - Intergenic
1099534382 12:83827028-83827050 ATGCTTACCTTATGTAACCAGGG + Intergenic
1099993644 12:89753305-89753327 CTGCTGACCTACAGGGATCACGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104598416 12:130136047-130136069 CAGCTTCCCTTGAGGAGTCAAGG + Intergenic
1114213923 14:20641173-20641195 CTGCTTACAGAAAGGAAGCAAGG + Exonic
1114643499 14:24240599-24240621 CTGTTTCCCTTTAGGAATCTCGG - Exonic
1120317545 14:82915468-82915490 TAGCTTTCCTTAAGAAATCATGG - Intergenic
1120537215 14:85711838-85711860 CTGCTTTCCATTAGGCATCAAGG - Intergenic
1122067985 14:99186860-99186882 CTGCTTTCCATAAGGTATAAAGG + Intronic
1127698467 15:61474177-61474199 CTGATTGCCTTAAGAAATAAAGG + Intergenic
1128722339 15:69959487-69959509 CTGAGTACCTTCAGGAATGATGG - Intergenic
1130841634 15:87706299-87706321 CTGGTTGCCTTCAGGAATAAGGG - Intergenic
1131768458 15:95706877-95706899 CTGATTACCTTAGAGAATAATGG + Intergenic
1132036054 15:98485949-98485971 CTGTTTACATAAAGGAATCCTGG - Exonic
1137569046 16:49552813-49552835 CTGCTTGCCTTTTGGGATCATGG - Intronic
1143560250 17:7689476-7689498 CTACTTCCCTCAAGGATTCAGGG + Intronic
1146270975 17:31485636-31485658 CTGCTGAGCTTAAGGTCTCAGGG + Intronic
1146576051 17:33992527-33992549 CTGCTTACCTTAAGGGTGCGGGG + Intronic
1148143049 17:45341931-45341953 CAGCCTACCTTCAGGAGTCAAGG - Intergenic
1153280763 18:3411974-3411996 CAGCTTATCTTAAGGAAGCCTGG + Intronic
1154366806 18:13717871-13717893 CTGCTGGCCTCAAGGAAACAAGG + Intronic
1155857938 18:30858103-30858125 CTGAATATCTTAAGGAATTATGG + Intergenic
1158707090 18:59802415-59802437 CTGCTGACCTCAAGTAATCGGGG + Intergenic
1159428336 18:68318976-68318998 TTGCCTACATTATGGAATCATGG - Intergenic
1164052035 19:21592076-21592098 CAGCTTCCCATAAGGCATCAGGG + Intergenic
1166729606 19:45051610-45051632 CTGCTAACCTTCAGAAATAAGGG - Intronic
927193469 2:20532585-20532607 ATCCTTACCTTAAAAAATCAAGG - Intergenic
929264576 2:39903816-39903838 CTGCTGACCAAAAGGACTCAGGG + Intergenic
933010373 2:77054694-77054716 CTGCTTAGTTTCAAGAATCATGG + Intronic
938700465 2:133873566-133873588 ATGCTTTCCTTAAAGAATCAAGG - Intergenic
945250941 2:207766444-207766466 CAGCTCACCTTAAAGAATCATGG + Exonic
1169407952 20:5340457-5340479 GTGCTTACATTAAAGAAACAAGG + Intergenic
1169823719 20:9742976-9742998 CTAATTACCTGAAGCAATCAAGG - Intronic
1172439694 20:34956628-34956650 CTGCCTTTCTGAAGGAATCAGGG + Intergenic
1181313244 22:21956740-21956762 CCGCCTTCCTTAAGGCATCAGGG + Intergenic
1181346349 22:22222812-22222834 CCGCCTTCCTTAAGGCATCAGGG + Intergenic
1182228086 22:28815578-28815600 TTTCTTACCTTATGGAATAAAGG + Intergenic
1185028033 22:48426663-48426685 CTGCCTACCCTGAGGCATCATGG + Intergenic
951410324 3:22356377-22356399 ATGCTTTCCTTAAAAAATCAAGG - Intronic
952878457 3:37967666-37967688 GTGCTTATTTTAAGGAACCAAGG + Intronic
955492388 3:59496175-59496197 CTGCTTACCTTAGTGACTCAGGG - Intergenic
961250917 3:125504622-125504644 CTGCTTACCTCATTGAAACAAGG - Exonic
961455862 3:127023606-127023628 CTGGTTTCCTTATGGAATCCAGG + Intronic
961919665 3:130412926-130412948 CTTTTTACCTAAAGTAATCATGG + Intronic
962740572 3:138360370-138360392 CTGCTCATCTCATGGAATCACGG - Intronic
963388014 3:144621018-144621040 ATTATTACTTTAAGGAATCAGGG - Intergenic
965109821 3:164406533-164406555 CTTCTTACCTTCAAGAATCCGGG - Intergenic
966666296 3:182475098-182475120 CTGCTTATATTAAGGAAATATGG - Intergenic
969545060 4:7820624-7820646 CCGCTTCCCTTAGGGAGTCACGG - Intronic
978550659 4:109922263-109922285 CTGGTTACTCTAATGAATCATGG + Intronic
980175484 4:129339214-129339236 GTGATTACAATAAGGAATCATGG + Intergenic
980489143 4:133503383-133503405 TTGCTTACCTTAAGGAGCAAGGG - Intergenic
980537278 4:134144018-134144040 GTGGTTACCTTAAGGGATTAAGG - Intergenic
984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG + Intergenic
984350033 4:178578674-178578696 TTGCTTACACTAAGGAATTAGGG + Intergenic
985330389 4:188825105-188825127 ACGCTTACTTTACGGAATCAGGG - Intergenic
986341923 5:6796540-6796562 CAGCTTAGCTTATGGAGTCAAGG - Intergenic
989353737 5:40517763-40517785 CTGATTACCTAAAGGAACTAGGG + Intergenic
992156643 5:73961660-73961682 ATGCTAACCTTAAGGAATCAGGG - Intergenic
993837612 5:92834898-92834920 CTGCTGGCTTTGAGGAATCAAGG - Intergenic
1002986587 6:2195320-2195342 CTGATAGCCTTAAGGAATAATGG - Intronic
1003705833 6:8527821-8527843 TTGTATACCTTTAGGAATCAAGG + Intergenic
1004530429 6:16449804-16449826 CTCCTTATTTTAGGGAATCAGGG + Intronic
1005825576 6:29629847-29629869 CTGATTCCCTTAGGGAATAATGG + Intronic
1006150349 6:31983698-31983720 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006156650 6:32016436-32016458 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1009839126 6:69044113-69044135 ATGCTTACCCTAAAAAATCAGGG + Intronic
1014884190 6:126759564-126759586 ATGCATGCCTCAAGGAATCATGG - Intergenic
1017466649 6:154700219-154700241 CTGCTTTCCTTTAGAATTCAAGG - Intergenic
1018637146 6:165872584-165872606 CTGCCCACCCTAAGCAATCATGG - Intronic
1018905191 6:168071882-168071904 GTGCTGACCTTCAGGACTCAAGG + Intronic
1020010664 7:4804144-4804166 CTGCCTCCCTGCAGGAATCACGG + Intronic
1020550953 7:9604171-9604193 CATCTTATCTTAATGAATCAGGG - Intergenic
1023488920 7:40716244-40716266 CTTCTGACCTGATGGAATCAGGG - Intronic
1031682970 7:124697026-124697048 TTCCTTACCTTAAGGAGGCAAGG - Intergenic
1034651204 7:152691942-152691964 ATGCTTACCTTAATAAATTATGG + Intergenic
1041330243 8:56716430-56716452 CTATTTACCTTTAGGTATCATGG - Intergenic
1041348388 8:56924571-56924593 CTGCTCACCTTAAAGAAGGAAGG + Intergenic
1041546722 8:59053647-59053669 CTGCTTCCTTTATGGAATCTAGG + Intronic
1042165194 8:65938514-65938536 CTGCACACTTTAAGGAAGCATGG + Intergenic
1048056964 8:130876421-130876443 CTGATTAGCTTGAGCAATCAAGG - Intronic
1048199034 8:132356218-132356240 CTGCTCACCTTCAGCCATCACGG + Intronic
1051308134 9:15738285-15738307 CTTTTTTCCTTAATGAATCACGG - Intronic
1051417629 9:16859101-16859123 ATGCTTAACATCAGGAATCAAGG + Intronic
1053168372 9:35860629-35860651 CATCTCTCCTTAAGGAATCATGG + Intergenic
1057433211 9:95014607-95014629 CTGCTTACCACATGGAATCAGGG - Intronic
1058632243 9:107001086-107001108 CTTCTCACCATTAGGAATCAGGG - Intronic
1061774765 9:132954347-132954369 CTCCTGACCTTAAGCAATCCAGG - Intronic
1061815537 9:133192344-133192366 TTGCTTGCCTTAAAGAATCAAGG - Intergenic
1203774130 EBV:63340-63362 CTGTTTATCCTAATGAATCACGG + Intergenic
1186975694 X:14901690-14901712 CTGGAGGCCTTAAGGAATCAGGG - Intronic
1188659869 X:32745742-32745764 CTGCTTATAGTAATGAATCATGG + Intronic
1188672138 X:32893263-32893285 CAGCTTATGTTAAGGAAGCATGG - Intronic
1189772323 X:44438715-44438737 CTGCTTGTCTTAAGGAGTCTAGG + Intergenic
1190871096 X:54425318-54425340 CTGTCTACCTTAAGGAAGAAGGG + Intergenic
1198161191 X:134010403-134010425 CTTTTTATCATAAGGAATCATGG - Intergenic
1200734712 Y:6782074-6782096 CTGATTTCCTTAAGGGACCAGGG - Intergenic