ID: 1078952322

View in Genome Browser
Species Human (GRCh38)
Location 11:16148196-16148218
Sequence GGTCTAACTCAACAACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078952322_1078952329 23 Left 1078952322 11:16148196-16148218 CCAATCAGTTGTTGAGTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1078952329 11:16148242-16148264 CATTGTTTGAATAATATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 165
1078952322_1078952327 19 Left 1078952322 11:16148196-16148218 CCAATCAGTTGTTGAGTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952322_1078952328 20 Left 1078952322 11:16148196-16148218 CCAATCAGTTGTTGAGTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1078952328 11:16148239-16148261 CTTCATTGTTTGAATAATATGGG 0: 1
1: 0
2: 1
3: 31
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078952322 Original CRISPR GGTCTAACTCAACAACTGAT TGG (reversed) Intronic
903048236 1:20580761-20580783 GATATAAAGCAACAACTGATAGG + Intergenic
906903762 1:49866114-49866136 GGAGCAACTCTACAACTGATTGG + Intronic
908361154 1:63369290-63369312 GGGATAACTCCAGAACTGATTGG - Intronic
909284763 1:73801768-73801790 GGTTTAACTCAATAACAGAATGG - Intergenic
911360633 1:96872133-96872155 TGACTAACCCTACAACTGATAGG - Intergenic
911527171 1:99002015-99002037 GTAGTAACTCAACAAATGATGGG + Intronic
913384413 1:118243792-118243814 GCCCCAACCCAACAACTGATAGG + Intergenic
919058292 1:192598512-192598534 GGTCTATCTCTAAAACTGATGGG - Intergenic
919941039 1:202286434-202286456 TGTCTTTCTCAACAAGTGATTGG - Intronic
921873347 1:220166412-220166434 GGTCTAAGTGAAGGACTGATTGG + Intronic
1068186473 10:53592639-53592661 AGACCAACTCCACAACTGATTGG - Intergenic
1077737142 11:4803485-4803507 GTTCTAACTCCATAAATGATGGG + Exonic
1078952322 11:16148196-16148218 GGTCTAACTCAACAACTGATTGG - Intronic
1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG + Exonic
1080553930 11:33398695-33398717 AGTCTAACACAACCATTGATAGG + Intergenic
1083525673 11:63362262-63362284 GGTATAACTGAACAAGTGCTGGG + Intronic
1084356182 11:68640351-68640373 GCCCCAACCCAACAACTGATAGG - Intergenic
1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG + Intergenic
1094284488 12:28777612-28777634 GGTTGAACTCAACAAATGCTAGG - Intergenic
1099077365 12:78127352-78127374 GGGCTATCTCACCAACTGTTCGG - Intronic
1110839780 13:80128612-80128634 GATCTAACTCAATAACTGTAGGG + Intergenic
1118193409 14:63602096-63602118 GTACTAACTCAAGAACTGTTAGG + Intronic
1121928659 14:97952142-97952164 CCTCTAACTCAACAACCCATTGG + Intronic
1121973598 14:98382231-98382253 GCTCTTTCTGAACAACTGATTGG + Intergenic
1126662721 15:51048374-51048396 GGTCTTACTCAACCCCTGACAGG + Intergenic
1128314506 15:66652203-66652225 GGTCTAACTCATTGACAGATGGG - Intronic
1129808984 15:78491004-78491026 AGTCTAAATAAACAGCTGATTGG + Intronic
1130123346 15:81071089-81071111 GGACGAACTTAACATCTGATTGG - Intronic
1141813535 16:86393012-86393034 GGTCTACATCTGCAACTGATGGG + Intergenic
1150095266 17:62368583-62368605 GGTCTAAATTAAGAAGTGATTGG - Intergenic
1156218615 18:35028107-35028129 GGTCTAGGTCAAGAACTGGTCGG + Intronic
1159816617 18:73081851-73081873 AGACAAATTCAACAACTGATCGG + Intergenic
1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG + Intronic
925255249 2:2479222-2479244 AGTCTAACAGAACCACTGATAGG + Intergenic
943350106 2:186786794-186786816 AGTCTGAATCTACAACTGATTGG + Intergenic
946041986 2:216790566-216790588 GGTCTAACTTAAAAACTCTTAGG + Intergenic
1172576753 20:36015062-36015084 GGTATGACTCAACATCTCATTGG + Intronic
1184948642 22:47823037-47823059 GGCCCAACTCAACTACTGAGTGG + Intergenic
955751358 3:62188050-62188072 TGTTTTACTCAACAACTCATGGG - Intronic
957507349 3:81139647-81139669 GGTCTAATTCCACAACATATGGG + Intergenic
959070970 3:101701845-101701867 GGTGGAACTCAACAGCTGGTGGG - Intergenic
960009494 3:112817986-112818008 GGTTTATCTCAAGATCTGATAGG - Intronic
969207018 4:5654763-5654785 GGCCTGACTCAACAACAGAGTGG - Intronic
971368184 4:25994209-25994231 CCTCCAACTCCACAACTGATAGG + Intergenic
978207785 4:106100181-106100203 CTTCTATCTAAACAACTGATAGG + Intronic
983387271 4:167081173-167081195 GTTCTAGCTCAACAACTAACTGG + Intronic
986928533 5:12790260-12790282 GCTCTAACTATTCAACTGATAGG - Intergenic
988684846 5:33516186-33516208 GGTCTCACTCAACAAGTGAGTGG - Intergenic
999087222 5:148903657-148903679 GGGCTAACTCATAAACTGCTGGG - Intergenic
1012313254 6:97754816-97754838 GCTTTAACTCCACAACTGGTAGG + Intergenic
1017209935 6:151844405-151844427 GGTCTAACTGCACAACTGGATGG + Intronic
1020354318 7:7260225-7260247 GATTTCACTCAACACCTGATTGG - Intergenic
1020965057 7:14855140-14855162 GGTCTATCTCAAAAAAAGATTGG + Intronic
1029861130 7:103573303-103573325 AGTCTAAATCAGCAACTGACAGG - Intronic
1041318759 8:56592306-56592328 GGTCAAACTTAACAATTAATAGG + Intergenic
1042498870 8:69487361-69487383 TGTCAAACACAACAAATGATGGG + Intronic
1046672394 8:117070567-117070589 TGTCTAACCAAACAAATGATAGG - Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1192334585 X:70206865-70206887 CTTATAACTCAACAACTGAAAGG + Intergenic
1198420202 X:136464307-136464329 GGACAAACTCGACAACAGATTGG - Intergenic