ID: 1078952323

View in Genome Browser
Species Human (GRCh38)
Location 11:16148217-16148239
Sequence GAATAAAAAAAGGCTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 635}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078952323_1078952327 -2 Left 1078952323 11:16148217-16148239 CCACCCATAGCCTTTTTTTATTC 0: 1
1: 1
2: 2
3: 39
4: 635
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952323_1078952329 2 Left 1078952323 11:16148217-16148239 CCACCCATAGCCTTTTTTTATTC 0: 1
1: 1
2: 2
3: 39
4: 635
Right 1078952329 11:16148242-16148264 CATTGTTTGAATAATATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 165
1078952323_1078952328 -1 Left 1078952323 11:16148217-16148239 CCACCCATAGCCTTTTTTTATTC 0: 1
1: 1
2: 2
3: 39
4: 635
Right 1078952328 11:16148239-16148261 CTTCATTGTTTGAATAATATGGG 0: 1
1: 0
2: 1
3: 31
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078952323 Original CRISPR GAATAAAAAAAGGCTATGGG TGG (reversed) Intronic